Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | bsrH-as-bsrH/- |
| Location | 2678799..2679077 | Replicon | chromosome |
| Accession | NC_000964 | ||
| Organism | Bacillus subtilis subsp. subtilis str. 168 | ||
| T1TAdb ID | TA04736 | ||
Toxin (Protein)
| Gene name | bsrH | Uniprot ID | - |
| Locus tag | BSU_26055 | Protein ID | YP_009513980.1 |
| Coordinates | 2678799..2678888 (+) | Length | 30 a.a. |
Antitoxin (RNA)
| Gene name | as-bsrH | ||
| Locus tag | - | ||
| Coordinates | 2678876..2679077 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| BSU_26050 (BSU26050) | 2678240..2678419 | + | 180 | NP_390482.1 | toxic peptide of toxin-antitoxin system; skin element | - |
| BSU_26055 (BSU26055) | 2678799..2678888 | + | 90 | YP_009513980.1 | skin region; type I toxin | Toxin |
| - | 2678876..2679077 | - | 202 | - | - | Antitoxin |
| BSU_26060 (BSU26060) | 2679142..2679585 | - | 444 | NP_390483.2 | putative tail tube protein; skin element | - |
| BSU_26075 (BSU26075) | 2679588..2680988 | - | 1401 | NP_390485.2 | putative phage tail sheath protein; skin element | - |
| BSU_26089 (BSU26089) | 2680989..2681180 | - | 192 | YP_003097763.1 | conserved phage protein of unknown function; skin element | - |
| BSU_26090 (BSU26090) | 2681177..2681614 | - | 438 | NP_390486.2 | conserved phage protein of unknown function; skin element | - |
| BSU_26100 (BSU26100) | 2681627..2682130 | - | 504 | NP_390487.1 | putative phage tail component; skin element | - |
| BSU_26110 (BSU26110) | 2682127..2682489 | - | 363 | NP_390488.1 | conserved phage protein of unknown function; skin element | - |
| BSU_26120 (BSU26120) | 2682486..2682881 | - | 396 | NP_390489.2 | conserved phage protein of unknown function; skin element | - |
| BSU_26130 (BSU26130) | 2682885..2683196 | - | 312 | NP_390490.1 | hypothetical protein; skin element | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | - | 2645490..2699243 | 53753 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 30 a.a. Molecular weight: 3317.16 Da Isoelectric Point: 10.6389
>T10201 YP_009513980.1 NC_000964:2678799-2678888 [Bacillus subtilis subsp. subtilis str. 168]
MHVSTFQALMLMLAFGSFIIALLTYIKKK
MHVSTFQALMLMLAFGSFIIALLTYIKKK
Download Length: 90 bp
>T10201 NC_000964:2678799-2678888 [Bacillus subtilis subsp. subtilis str. 168]
ATGCACGTGTCAACATTTCAAGCATTAATGCTTATGCTTGCTTTCGGGTCATTTATAATTGCCCTGTTGACTTATATAAA
GAAGAAATAG
ATGCACGTGTCAACATTTCAAGCATTAATGCTTATGCTTGCTTTCGGGTCATTTATAATTGCCCTGTTGACTTATATAAA
GAAGAAATAG
Antitoxin
Download Length: 202 bp
>AT10201 NC_000964:c2679077-2678876 [Bacillus subtilis subsp. subtilis str. 168]
TTAGAAGTAATTCAACCGTACCAAATGGAAACATGTATTTCTTTCAAAAGAAATGCATAAAATAAAAGAGACCCGGTTGC
CGCCGGGTCAGTATAAATGTTGGCCCATCAAGAGGGCTGGCTTAACAACTTCATGAAAGTATTTAGGATAGACTTTACCC
TTTTACTTTGCCGAGCTCAAGGGGTGGGTCTATTTCTTCTTT
TTAGAAGTAATTCAACCGTACCAAATGGAAACATGTATTTCTTTCAAAAGAAATGCATAAAATAAAAGAGACCCGGTTGC
CGCCGGGTCAGTATAAATGTTGGCCCATCAAGAGGGCTGGCTTAACAACTTCATGAAAGTATTTAGGATAGACTTTACCC
TTTTACTTTGCCGAGCTCAAGGGGTGGGTCTATTTCTTCTTT
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| T10200 | Bacillus subtilis subsp. subtilis str. 168 |
92 |
86.207 |
0.793 |
| T6278 | Enterococcus faecalis V583 |
40.741 |
100 |
0.407 |
| T10205 | Enterococcus faecalis V583 |
52.381 |
72.414 |
0.379 |
| T10207 | Enterococcus faecalis V583 |
60 |
57.692 |
0.346 |
| T10204 | Enterococcus faecalis V583 |
40 |
86.207 |
0.345 |
| T10049 | Staphylococcus aureus strain HG003 isolate RN1 Scaffold_9 |
47.619 |
72.414 |
0.345 |
| T10146 | Staphylococcus aureus strain HG003 isolate RN1 Scaffold_5 |
52.941 |
58.621 |
0.31 |
| T6360 | Staphylococcus aureus subsp. aureus N315 |
52.941 |
58.621 |
0.31 |
Multiple sequence alignment
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
References
(1) Sylvain Durand et al. (2012) Type I toxin-antitoxin systems in Bacillus subtilis. RNA Biology 9(12):1491-7. [PubMed:23059907]