Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | sprG-sprF/- |
| Location | 563797..564046 | Replicon | chromosome |
| Accession | NZ_JPPU01000009 | ||
| Organism | Staphylococcus aureus strain HG003 isolate RN1 Scaffold_9 | ||
Toxin (Protein)
| Gene name | SprG2 | Uniprot ID | - |
| Locus tag | - | Protein ID | - |
| Coordinates | 563942..564046 (-) | Length | 35 a.a. |
Antitoxin (RNA)
| Gene name | SprF2 | ||
| Locus tag | - | ||
| Coordinates | 563797..563944 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| IM26_RS23595 (IM26_08750) | 559104..559391 | - | 288 | WP_000410720.1 | hypothetical protein | - |
| IM26_RS28755 (IM26_08755) | 559670..559960 | + | 291 | WP_001795544.1 | hypothetical protein | - |
| IM26_RS23605 (IM26_08760) | 560048..560689 | - | 642 | WP_000571178.1 | ABC transporter ATP-binding protein | - |
| IM26_RS23610 (IM26_08765) | 560686..561006 | - | 321 | WP_000668623.1 | YxeA family protein | - |
| IM26_RS23615 (IM26_08770) | 561009..562973 | - | 1965 | WP_000870806.1 | bacteriocin-associated integral membrane family protein | - |
| IM26_RS28760 | 563017..563277 | - | 261 | WP_130137088.1 | lactococcin 972 family bacteriocin | - |
| IM26_RS0114625 | 563299..563400 | - | 102 | WP_001790623.1 | hypothetical protein | - |
| - | 563797..563944 | + | 148 | - | - | Antitoxin |
| - | 563942..564046 | - | 105 | - | - | Toxin |
| IM26_RS23620 (IM26_08780) | 564317..564919 | - | 603 | WP_001033867.1 | CPBP family glutamic-type intramembrane protease | - |
| IM26_RS0114635 | 564934..565110 | - | 177 | WP_000214898.1 | YkvS family protein | - |
| IM26_RS23625 (IM26_08790) | 565309..566295 | + | 987 | WP_000668820.1 | lipoate--protein ligase | - |
| IM26_RS23630 (IM26_08795) | 566376..566594 | - | 219 | WP_000876826.1 | IDEAL domain-containing protein | - |
| IM26_RS23635 (IM26_08800) | 566804..567373 | + | 570 | WP_000287265.1 | competence protein ComK | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 35 a.a. Molecular weight: 3788.69 Da Isoelectric Point: 10.8004
>T10049 - NZ_JPPU01000009:c564046-563942 [Staphylococcus aureus]
VISIANALHLMLSFGMFIVTFIGIVVAIINLSNKK
VISIANALHLMLSFGMFIVTFIGIVVAIINLSNKK
Download Length: 105 bp
>T10049 NZ_JPPU01000009:c564046-563942 [Staphylococcus aureus]
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTATAGTAGTAGC
AATAATAAATTTAAGCAATAAAAAA
GTGATATCTATTGCAAACGCATTACATTTAATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTATAGTAGTAGC
AATAATAAATTTAAGCAATAAAAAA
Antitoxin
Download Length: 148 bp
>AT10049 NZ_JPPU01000009:563797-563944 [Staphylococcus aureus]
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCTATGTCAAAGTTTTGAAATGATGGTTATTT
CAATTAAATAAAAGATATGTTACTATAAAAATGTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAA
AGACGGTGACTAAATGAGATTTTCTTTAACCATCATTCTATGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| T10025 | Staphylococcus aureus subsp. aureus N315 |
100 |
100 |
1 |
| T10207 | Enterococcus faecalis V583 |
52 |
96.154 |
0.5 |
| T10205 | Enterococcus faecalis V583 |
45.714 |
100 |
0.457 |
| T6360 | Staphylococcus aureus subsp. aureus N315 |
56 |
71.429 |
0.4 |
| T10146 | Staphylococcus aureus strain HG003 isolate RN1 Scaffold_5 |
56 |
71.429 |
0.4 |
| T10154 | Staphylococcus aureus subsp. aureus MW2 |
56 |
71.429 |
0.4 |
| T10206 | Enterococcus faecalis V583 |
39.394 |
94.286 |
0.371 |
| T10201 | Bacillus subtilis subsp. subtilis str. 168 |
47.619 |
72.414 |
0.345 |
Multiple sequence alignment
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
References
(1) Camille Riffaud et al. (2019) Functionality and cross-regulation of the four SprG/SprF type I toxin-antitoxin systems in Staphylococcus aureus. Nucleic Acids Research 47(4):1740-1758. [PubMed:30551143]
(2) Charlotte Oriol et al. (2021) Expanding the Staphylococcus aureus SarA Regulon to Small RNAs. MSystems 6(5):e0071321. [PubMed:34636666]