Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | sprG-sprF/- |
| Location | 1006294..1006481 | Replicon | chromosome |
| Accession | NC_002745 | ||
| Organism | Staphylococcus aureus subsp. aureus N315 | ||
| T1TAdb ID | TA03805 | ||
Toxin (Protein)
| Gene name | SprG | Uniprot ID | - |
| Locus tag | SprG2 | Protein ID | - |
| Coordinates | 1006294..1006371 (+) | Length | 26 a.a. |
Antitoxin (RNA)
| Gene name | SprF | ||
| Locus tag | - | ||
| Coordinates | 1006366..1006481 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| SA_RS04995 (SA0882) | 1002938..1003507 | - | 570 | WP_000287265.1 | competence protein ComK | - |
| SA_RS05000 (SA0883) | 1003717..1003935 | + | 219 | WP_000876826.1 | IDEAL domain-containing protein | - |
| SA_RS05005 (SA0884) | 1004016..1005002 | - | 987 | WP_000668818.1 | lipoate--protein ligase | - |
| SA_RS05010 (SAS027) | 1005201..1005377 | + | 177 | WP_000214898.1 | YkvS family protein | - |
| SA_RS05015 (SA0885) | 1005392..1005994 | + | 603 | WP_001033865.1 | CPBP family intramembrane metalloprotease | - |
| SA_RS05020 | 1006226..1006371 | + | 146 | Protein_930 | putative holin-like toxin | - |
| - | 1006294..1006371 | + | 78 | - | - | Toxin |
| - | 1006366..1006481 | - | 116 | - | - | Antitoxin |
| SA_RS05025 | 1006910..1007011 | + | 102 | WP_001792055.1 | hypothetical protein | - |
| SA_RS14630 | 1007021..1007293 | + | 273 | WP_001797239.1 | lactococcin 972 family bacteriocin | - |
| SA_RS05030 (SA0886) | 1007337..1009301 | + | 1965 | WP_000870829.1 | bacteriocin-associated integral membrane family protein | - |
| SA_RS05035 (SA0887) | 1009304..1009624 | + | 321 | WP_000668627.1 | YxeA family protein | - |
| SA_RS05040 (SA0888) | 1009621..1010262 | + | 642 | WP_000571167.1 | ABC transporter ATP-binding protein | - |
| SA_RS14635 | 1010350..1010640 | - | 291 | WP_001795266.1 | hypothetical protein | - |
| SA_RS14640 | 1010781..1010918 | + | 138 | WP_001792054.1 | poly(glycerol-phosphate) alpha-glucosyltransferase | - |
| SA_RS05050 (SA0890) | 1011007..1011363 | - | 357 | WP_000766009.1 | DoxX family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 26 a.a. Molecular weight: 2756.44 Da Isoelectric Point: 10.8004
>T10025 NC_002745:1006294-1006371 [Staphylococcus aureus subsp. aureus N315]
MLSFGMFIVTFIGIVVAIINLSNKK
MLSFGMFIVTFIGIVVAIINLSNKK
Download Length: 78 bp
>T10025 NC_002745:1006294-1006371 [Staphylococcus aureus subsp. aureus N315]
ATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTATAGTAGTAGCAATAATAAATTTAAGCAATAAAAAATAA
ATGTTAAGTTTCGGTATGTTTATCGTCACTTTCATTGGTATAGTAGTAGCAATAATAAATTTAAGCAATAAAAAATAA
Antitoxin
Download Length: 116 bp
>AT10025 NC_002745:c1006481-1006366 [Staphylococcus aureus subsp. aureus N315]
GTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGACTAAATGAGATTTTCTTTAACCA
TCATTCTATGTCAAAGTTTTGAAATGATGGTTATTT
GTAAAAAGACGACATGCAGGAACATGTCGCCTAATGAGCCCGTTAAAAAGACGGTGACTAAATGAGATTTTCTTTAACCA
TCATTCTATGTCAAAGTTTTGAAATGATGGTTATTT
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| T10049 | Staphylococcus aureus strain HG003 isolate RN1 Scaffold_9 |
100 |
100 |
1 |
| T6360 | Staphylococcus aureus subsp. aureus N315 |
56 |
100 |
0.56 |
| T10154 | Staphylococcus aureus subsp. aureus MW2 |
56 |
100 |
0.56 |
| T10146 | Staphylococcus aureus strain HG003 isolate RN1 Scaffold_5 |
56 |
100 |
0.56 |
| T10207 | Enterococcus faecalis V583 |
52 |
100 |
0.52 |
| T10205 | Enterococcus faecalis V583 |
40 |
100 |
0.4 |
Multiple sequence alignment
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
References
(1) Marie-Laure Pinel-Marie et al. (2014) Dual toxic-peptide-coding Staphylococcus aureus RNA under antisense regulation targets host cells and bacterial rivals unequally. Cell Reports 7(2):424-435. [PubMed:24703849]
(2) Camille Riffaud et al. (2019) Functionality and cross-regulation of the four SprG/SprF type I toxin-antitoxin systems in Staphylococcus aureus. Nucleic Acids Research 47(4):1740-1758. [PubMed:30551143]