Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1925619..1925764 | Replicon | |
| Accession | NC_016810 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1925621..1925724 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1925619..1925764 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| SL1344_RS09320 (SL1344_1799) | 1920747..1920947 | + | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
| SL1344_RS27675 | 1921044..1921514 | - | 471 | Protein_1832 | tail fiber assembly protein | - |
| SL1344_RS27680 | 1921524..1921868 | - | 345 | Protein_1833 | macro domain-containing protein | - |
| SL1344_RS09330 (SL1344_1801) | 1922083..1922343 | - | 261 | Protein_1834 | DUF1441 family protein | - |
| SL1344_RS09335 | 1922398..1922586 | + | 189 | WP_001521334.1 | hypothetical protein | - |
| SL1344_RS09340 (SL1344_1802) | 1922651..1922818 | + | 168 | WP_000789530.1 | lytic enzyme | - |
| SL1344_RS09345 (SL1344_1803) | 1923075..1923608 | - | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| SL1344_RS09350 (SL1344_1804) | 1923662..1923853 | - | 192 | Protein_1838 | glycoside hydrolase family 19 protein | - |
| SL1344_RS27685 | 1923842..1924303 | + | 462 | Protein_1839 | DNA breaking-rejoining protein | - |
| SL1344_RS26685 (SL1344_1806) | 1924567..1925490 | + | 924 | Protein_1840 | tyrosine-type recombinase/integrase | - |
| - | 1925619..1925764 | + | 146 | - | - | Antitoxin |
| - | 1925621..1925724 | - | 104 | - | - | Toxin |
| SL1344_RS09370 (SL1344_1807) | 1925864..1926217 | - | 354 | WP_000722368.1 | YebY family protein | - |
| SL1344_RS09375 (SL1344_1808) | 1926234..1927109 | - | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| SL1344_RS09380 (SL1344_1809) | 1927110..1927484 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| SL1344_RS09385 (SL1344_1810) | 1927622..1927852 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| SL1344_RS09390 (SL1344_1811) | 1927960..1928616 | + | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| SL1344_RS09395 (SL1344_1812) | 1928640..1929338 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | - | 1910986..1947632 | 36646 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T25947 NC_016810:c1925724-1925621 [Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT25947 NC_016810:1925619-1925764 [Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
