Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2126146..2126291 | Replicon | chromosome |
| Accession | NZ_AP023304 | ||
| Organism | Salmonella enterica subsp. enterica serovar 4[5]12:i:- strain L-4551 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2126186..2126289 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2126146..2126291 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| K5676_RS10345 | 2122572..2123270 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| K5676_RS10350 | 2123294..2123950 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| K5676_RS10355 | 2124058..2124288 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| K5676_RS10360 | 2124426..2124800 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| K5676_RS10365 | 2124801..2125676 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| K5676_RS10370 | 2125693..2126046 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2126146..2126291 | - | 146 | - | - | Antitoxin |
| - | 2126186..2126289 | + | 104 | - | - | Toxin |
| K5676_RS10375 | 2126420..2127343 | - | 924 | Protein_2038 | tyrosine-type recombinase/integrase | - |
| K5676_RS25025 | 2127607..2128068 | - | 462 | Protein_2039 | DNA breaking-rejoining protein | - |
| K5676_RS10385 | 2128057..2128248 | + | 192 | Protein_2040 | glycoside hydrolase family 19 protein | - |
| K5676_RS10390 | 2128302..2128835 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| K5676_RS10395 | 2129092..2129259 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| K5676_RS10400 | 2129324..2129512 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| K5676_RS10405 | 2129567..2129827 | + | 261 | Protein_2044 | DUF1441 family protein | - |
| K5676_RS10410 | 2130042..2130386 | + | 345 | Protein_2045 | macro domain-containing protein | - |
| K5676_RS10415 | 2130396..2130866 | + | 471 | Protein_2046 | tail fiber assembly protein | - |
| K5676_RS10420 | 2130963..2131163 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2106149..2148486 | 42337 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T37396 NZ_AP023304:2126186-2126289 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT37396 NZ_AP023304:c2126291-2126146 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG