Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1925974..1926119 | Replicon | chromosome |
| Accession | NZ_CP047535 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10452 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1926014..1926117 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1925974..1926119 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DXN08_RS09445 | 1922400..1923098 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| DXN08_RS09450 | 1923122..1923778 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| DXN08_RS09455 | 1923886..1924116 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| DXN08_RS09460 | 1924254..1924628 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| DXN08_RS09465 | 1924629..1925504 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| DXN08_RS09470 | 1925521..1925874 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 1925974..1926119 | - | 146 | - | - | Antitoxin |
| - | 1926014..1926117 | + | 104 | - | - | Toxin |
| DXN08_RS09475 | 1926248..1927171 | - | 924 | Protein_1854 | tyrosine-type recombinase/integrase | - |
| DXN08_RS09480 | 1927435..1927896 | - | 462 | Protein_1855 | DNA breaking-rejoining protein | - |
| DXN08_RS09485 | 1927885..1928076 | + | 192 | Protein_1856 | glycoside hydrolase family 19 protein | - |
| DXN08_RS09490 | 1928130..1928663 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| DXN08_RS09495 | 1928920..1929087 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| DXN08_RS09500 | 1929152..1929340 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| DXN08_RS09505 | 1929395..1929655 | + | 261 | Protein_1860 | DUF1441 family protein | - |
| DXN08_RS09510 | 1929870..1930214 | + | 345 | Protein_1861 | macro domain-containing protein | - |
| DXN08_RS09515 | 1930224..1930694 | + | 471 | Protein_1862 | tail fiber assembly protein | - |
| DXN08_RS09520 | 1930791..1930991 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 1905977..1948313 | 42336 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T146463 NZ_CP047535:1926014-1926117 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT146463 NZ_CP047535:c1926119-1925974 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG