Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 1925974..1926119 Replicon chromosome
Accession NZ_CP047535
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10452

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 1926014..1926117 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 1925974..1926119 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
DXN08_RS09445 1922400..1923098 - 699 WP_000944282.1 exodeoxyribonuclease X -
DXN08_RS09450 1923122..1923778 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
DXN08_RS09455 1923886..1924116 - 231 WP_000856224.1 DNA polymerase III subunit theta -
DXN08_RS09460 1924254..1924628 + 375 WP_000168393.1 CopC domain-containing protein YobA -
DXN08_RS09465 1924629..1925504 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
DXN08_RS09470 1925521..1925874 + 354 WP_000722368.1 YebY family protein -
- 1925974..1926119 - 146 - - Antitoxin
- 1926014..1926117 + 104 - - Toxin
DXN08_RS09475 1926248..1927171 - 924 Protein_1854 tyrosine-type recombinase/integrase -
DXN08_RS09480 1927435..1927896 - 462 Protein_1855 DNA breaking-rejoining protein -
DXN08_RS09485 1927885..1928076 + 192 Protein_1856 glycoside hydrolase family 19 protein -
DXN08_RS09490 1928130..1928663 + 534 WP_001050882.1 DUF2514 domain-containing protein -
DXN08_RS09495 1928920..1929087 - 168 WP_000789530.1 lytic enzyme -
DXN08_RS09500 1929152..1929340 - 189 WP_001521334.1 hypothetical protein -
DXN08_RS09505 1929395..1929655 + 261 Protein_1860 DUF1441 family protein -
DXN08_RS09510 1929870..1930214 + 345 Protein_1861 macro domain-containing protein -
DXN08_RS09515 1930224..1930694 + 471 Protein_1862 tail fiber assembly protein -
DXN08_RS09520 1930791..1930991 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 1905977..1948313 42336


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T146463 NZ_CP047535:1926014-1926117 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT146463 NZ_CP047535:c1926119-1925974 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References