Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2135978..2136123 Replicon chromosome
Accession NZ_CP091571
Organism Salmonella enterica strain

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2136018..2136121 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2135978..2136123 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
INN74_RS10435 2132404..2133102 - 699 WP_000944282.1 exodeoxyribonuclease X -
INN74_RS10440 2133126..2133782 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
INN74_RS10445 2133890..2134120 - 231 WP_000856224.1 DNA polymerase III subunit theta -
INN74_RS10450 2134258..2134632 + 375 WP_000168393.1 CopC domain-containing protein YobA -
INN74_RS10455 2134633..2135508 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
INN74_RS10460 2135525..2135878 + 354 WP_000722368.1 YebY family protein -
- 2135978..2136123 - 146 - - Antitoxin
- 2136018..2136121 + 104 - - Toxin
INN74_RS10465 2136252..2137175 - 924 Protein_2051 tyrosine-type recombinase/integrase -
INN74_RS10470 2137439..2137900 - 462 Protein_2052 DNA breaking-rejoining protein -
INN74_RS10475 2137889..2138080 + 192 Protein_2053 glycoside hydrolase family 19 protein -
INN74_RS10480 2138134..2138667 + 534 WP_001050882.1 DUF2514 domain-containing protein -
INN74_RS10485 2138924..2139091 - 168 WP_000789530.1 lytic enzyme -
INN74_RS10490 2139156..2139344 - 189 WP_001521334.1 hypothetical protein -
INN74_RS10495 2139399..2139659 + 261 Protein_2057 DUF1441 family protein -
INN74_RS10500 2139874..2140218 + 345 Protein_2058 macro domain-containing protein -
INN74_RS10505 2140228..2140698 + 471 Protein_2059 tail fiber assembly protein -
INN74_RS10510 2140795..2140995 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2115981..2158318 42337


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T233861 NZ_CP091571:2136018-2136121 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT233861 NZ_CP091571:c2136123-2135978 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References