Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 713627..713772 | Replicon | chromosome |
| Accession | NZ_CP064385 | ||
| Organism | Salmonella enterica subsp. enterica strain PartC-Senterica-RM8376 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 713629..713732 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 713627..713772 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| IUJ38_RS03585 | 708755..708955 | + | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
| IUJ38_RS03590 | 709052..709522 | - | 471 | Protein_707 | tail fiber assembly protein | - |
| IUJ38_RS03595 | 709532..709876 | - | 345 | Protein_708 | macro domain-containing protein | - |
| IUJ38_RS03600 | 710091..710351 | - | 261 | Protein_709 | DUF1441 family protein | - |
| IUJ38_RS03605 | 710406..710594 | + | 189 | WP_001521334.1 | hypothetical protein | - |
| IUJ38_RS03610 | 710659..710826 | + | 168 | WP_000789530.1 | lytic enzyme | - |
| IUJ38_RS03615 | 711083..711616 | - | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| IUJ38_RS03620 | 711670..711861 | - | 192 | Protein_713 | glycoside hydrolase family 19 protein | - |
| IUJ38_RS03625 | 711850..712311 | + | 462 | Protein_714 | DNA breaking-rejoining protein | - |
| IUJ38_RS03630 | 712575..713498 | + | 924 | Protein_715 | tyrosine-type recombinase/integrase | - |
| - | 713627..713772 | + | 146 | - | - | Antitoxin |
| - | 713629..713732 | - | 104 | - | - | Toxin |
| IUJ38_RS03635 | 713872..714225 | - | 354 | WP_000722368.1 | YebY family protein | - |
| IUJ38_RS03640 | 714242..715117 | - | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| IUJ38_RS03645 | 715118..715492 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| IUJ38_RS03650 | 715630..715860 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| IUJ38_RS03655 | 715968..716624 | + | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| IUJ38_RS03660 | 716648..717346 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 691440..735640 | 44200 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T181063 NZ_CP064385:c713732-713629 [Salmonella enterica subsp. enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT181063 NZ_CP064385:713627-713772 [Salmonella enterica subsp. enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
