Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2134243..2134388 | Replicon | chromosome |
Accession | NZ_CP091556 | ||
Organism | Salmonella enterica strain 632 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2134283..2134386 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2134243..2134388 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
INN80_RS10470 | 2130669..2131367 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
INN80_RS10475 | 2131391..2132047 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
INN80_RS10480 | 2132155..2132385 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
INN80_RS10485 | 2132523..2132897 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
INN80_RS10490 | 2132898..2133773 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
INN80_RS10495 | 2133790..2134143 | + | 354 | WP_000722368.1 | YebY family protein | - |
- | 2134243..2134388 | - | 146 | - | - | Antitoxin |
- | 2134283..2134386 | + | 104 | - | - | Toxin |
INN80_RS10500 | 2134517..2135440 | - | 924 | Protein_2059 | tyrosine-type recombinase/integrase | - |
INN80_RS10505 | 2135704..2136165 | - | 462 | Protein_2060 | DNA breaking-rejoining protein | - |
INN80_RS10510 | 2136154..2136345 | + | 192 | Protein_2061 | glycoside hydrolase family 19 protein | - |
INN80_RS10515 | 2136399..2136932 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
INN80_RS10520 | 2137189..2137356 | - | 168 | WP_000789530.1 | lytic enzyme | - |
INN80_RS10525 | 2137421..2137609 | - | 189 | WP_001521334.1 | hypothetical protein | - |
INN80_RS10530 | 2137664..2137924 | + | 261 | Protein_2065 | DUF1441 family protein | - |
INN80_RS10535 | 2138139..2138483 | + | 345 | Protein_2066 | macro domain-containing protein | - |
INN80_RS10540 | 2138493..2138963 | + | 471 | Protein_2067 | tail fiber assembly protein | - |
INN80_RS10545 | 2139060..2139260 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
inside | Prophage | - | sopE2 | 2112375..2156583 | 44208 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T233704 NZ_CP091556:2134283-2134386 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT233704 NZ_CP091556:c2134388-2134243 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG