Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 4454722..4454867 Replicon chromosome
Accession NZ_CP085820
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain Wartortle

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 4454724..4454827 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 4454722..4454867 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
LJF64_RS21420 4449850..4450050 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
LJF64_RS21425 4450147..4450617 - 471 Protein_4170 tail fiber assembly protein -
LJF64_RS21430 4450627..4450971 - 345 Protein_4171 macro domain-containing protein -
LJF64_RS21435 4451186..4451446 - 261 Protein_4172 DUF1441 family protein -
LJF64_RS21440 4451501..4451689 + 189 WP_001521334.1 hypothetical protein -
LJF64_RS21445 4451754..4451921 + 168 WP_000789530.1 lytic enzyme -
LJF64_RS21450 4452178..4452711 - 534 WP_001050882.1 DUF2514 domain-containing protein -
LJF64_RS21455 4452765..4452956 - 192 Protein_4176 glycoside hydrolase family 19 protein -
LJF64_RS21460 4452945..4453406 + 462 Protein_4177 DNA breaking-rejoining protein -
LJF64_RS21465 4453670..4454593 + 924 Protein_4178 tyrosine-type recombinase/integrase -
- 4454722..4454867 + 146 - - Antitoxin
- 4454724..4454827 - 104 - - Toxin
LJF64_RS21470 4454967..4455320 - 354 WP_000722368.1 YebY family protein -
LJF64_RS21475 4455337..4456212 - 876 WP_000979702.1 copper homeostasis membrane protein CopD -
LJF64_RS21480 4456213..4456587 - 375 WP_000168393.1 CopC domain-containing protein YobA -
LJF64_RS21485 4456725..4456955 + 231 WP_000856224.1 DNA polymerase III subunit theta -
LJF64_RS21490 4457063..4457719 + 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
LJF64_RS21495 4457743..4458441 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 4429873..4476735 46862


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T221995 NZ_CP085820:c4454827-4454724 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT221995 NZ_CP085820:4454722-4454867 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References