Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2125751..2125896 Replicon chromosome
Accession NZ_CP117033
Organism Salmonella enterica strain PIW95_S14_0299

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2125791..2125894 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2125751..2125896 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
PQP07_RS10410 2122177..2122875 - 699 WP_000944282.1 exodeoxyribonuclease X -
PQP07_RS10415 2122899..2123555 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
PQP07_RS10420 2123663..2123893 - 231 WP_000856224.1 DNA polymerase III subunit theta -
PQP07_RS10425 2124031..2124405 + 375 WP_000168393.1 CopC domain-containing protein YobA -
PQP07_RS10430 2124406..2125281 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
PQP07_RS10435 2125298..2125651 + 354 WP_000722368.1 YebY family protein -
- 2125751..2125896 - 146 - - Antitoxin
- 2125791..2125894 + 104 - - Toxin
PQP07_RS10440 2126025..2126948 - 924 Protein_2042 tyrosine-type recombinase/integrase -
PQP07_RS10445 2127212..2127673 - 462 Protein_2043 DNA breaking-rejoining protein -
PQP07_RS10450 2127662..2127853 + 192 Protein_2044 glycoside hydrolase family 19 protein -
PQP07_RS10455 2127907..2128440 + 534 WP_001050882.1 DUF2514 domain-containing protein -
PQP07_RS10460 2128697..2128864 - 168 WP_000789530.1 lytic enzyme -
PQP07_RS10465 2128929..2129117 - 189 WP_001521334.1 hypothetical protein -
PQP07_RS10470 2129172..2129432 + 261 Protein_2048 DUF1441 family protein -
PQP07_RS10475 2129647..2129991 + 345 Protein_2049 macro domain-containing protein -
PQP07_RS10480 2130001..2130471 + 471 Protein_2050 tail fiber assembly protein -
PQP07_RS10485 2130568..2130768 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2105754..2145482 39728
inside Prophage - sopE2 2105754..2148091 42337


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T269885 NZ_CP117033:2125791-2125894 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT269885 NZ_CP117033:c2125896-2125751 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References