Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2125751..2125896 | Replicon | chromosome |
Accession | NZ_CP117033 | ||
Organism | Salmonella enterica strain PIW95_S14_0299 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2125791..2125894 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2125751..2125896 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PQP07_RS10410 | 2122177..2122875 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
PQP07_RS10415 | 2122899..2123555 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
PQP07_RS10420 | 2123663..2123893 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
PQP07_RS10425 | 2124031..2124405 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
PQP07_RS10430 | 2124406..2125281 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
PQP07_RS10435 | 2125298..2125651 | + | 354 | WP_000722368.1 | YebY family protein | - |
- | 2125751..2125896 | - | 146 | - | - | Antitoxin |
- | 2125791..2125894 | + | 104 | - | - | Toxin |
PQP07_RS10440 | 2126025..2126948 | - | 924 | Protein_2042 | tyrosine-type recombinase/integrase | - |
PQP07_RS10445 | 2127212..2127673 | - | 462 | Protein_2043 | DNA breaking-rejoining protein | - |
PQP07_RS10450 | 2127662..2127853 | + | 192 | Protein_2044 | glycoside hydrolase family 19 protein | - |
PQP07_RS10455 | 2127907..2128440 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
PQP07_RS10460 | 2128697..2128864 | - | 168 | WP_000789530.1 | lytic enzyme | - |
PQP07_RS10465 | 2128929..2129117 | - | 189 | WP_001521334.1 | hypothetical protein | - |
PQP07_RS10470 | 2129172..2129432 | + | 261 | Protein_2048 | DUF1441 family protein | - |
PQP07_RS10475 | 2129647..2129991 | + | 345 | Protein_2049 | macro domain-containing protein | - |
PQP07_RS10480 | 2130001..2130471 | + | 471 | Protein_2050 | tail fiber assembly protein | - |
PQP07_RS10485 | 2130568..2130768 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
inside | Prophage | - | sopE2 | 2105754..2145482 | 39728 | ||
inside | Prophage | - | sopE2 | 2105754..2148091 | 42337 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T269885 NZ_CP117033:2125791-2125894 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT269885 NZ_CP117033:c2125896-2125751 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG