Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2086207..2086352 | Replicon | chromosome |
| Accession | NZ_AP023319 | ||
| Organism | Salmonella enterica subsp. enterica serovar 4[5]12:i:- strain L-4741 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2086247..2086350 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2086207..2086352 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| K5619_RS10150 | 2082633..2083331 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| K5619_RS10155 | 2083355..2084011 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| K5619_RS10160 | 2084119..2084349 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| K5619_RS10165 | 2084487..2084861 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| K5619_RS10170 | 2084862..2085737 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| K5619_RS10175 | 2085754..2086107 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2086207..2086352 | - | 146 | - | - | Antitoxin |
| - | 2086247..2086350 | + | 104 | - | - | Toxin |
| K5619_RS10180 | 2086481..2087404 | - | 924 | Protein_2000 | tyrosine-type recombinase/integrase | - |
| K5619_RS24260 | 2087668..2088129 | - | 462 | Protein_2001 | DNA breaking-rejoining protein | - |
| K5619_RS10190 | 2088118..2088309 | + | 192 | Protein_2002 | glycoside hydrolase family 19 protein | - |
| K5619_RS10195 | 2088363..2088896 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| K5619_RS10200 | 2089153..2089320 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| K5619_RS10205 | 2089385..2089573 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| K5619_RS10210 | 2089628..2089888 | + | 261 | Protein_2006 | DUF1441 family protein | - |
| K5619_RS10215 | 2090103..2090447 | + | 345 | Protein_2007 | macro domain-containing protein | - |
| K5619_RS10220 | 2090457..2090927 | + | 471 | Protein_2008 | tail fiber assembly protein | - |
| K5619_RS10225 | 2091024..2091224 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2066210..2108547 | 42337 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T37582 NZ_AP023319:2086247-2086350 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT37582 NZ_AP023319:c2086352-2086207 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
