Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2014329..2014474 | Replicon | chromosome |
| Accession | NZ_CP100732 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain R18.1932 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2014369..2014472 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2014329..2014474 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NL737_RS09600 | 2010755..2011453 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NL737_RS09605 | 2011477..2012133 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| NL737_RS09610 | 2012241..2012471 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NL737_RS09615 | 2012609..2012983 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NL737_RS09620 | 2012984..2013859 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| NL737_RS09625 | 2013876..2014229 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2014329..2014474 | - | 146 | - | - | Antitoxin |
| - | 2014369..2014472 | + | 104 | - | - | Toxin |
| NL737_RS09630 | 2014603..2015526 | - | 924 | Protein_1882 | tyrosine-type recombinase/integrase | - |
| NL737_RS09635 | 2015790..2016251 | - | 462 | Protein_1883 | DNA breaking-rejoining protein | - |
| NL737_RS09640 | 2016240..2016431 | + | 192 | Protein_1884 | glycoside hydrolase family 19 protein | - |
| NL737_RS09645 | 2016485..2017018 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| NL737_RS09650 | 2017275..2017442 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NL737_RS09655 | 2017507..2017695 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| NL737_RS09660 | 2017750..2018010 | + | 261 | Protein_1888 | DUF1441 family protein | - |
| NL737_RS09665 | 2018012..2018227 | + | 216 | Protein_1889 | shikimate transporter | - |
| NL737_RS09670 | 2018225..2018569 | + | 345 | Protein_1890 | macro domain-containing protein | - |
| NL737_RS09675 | 2018579..2019049 | + | 471 | Protein_1891 | tail fiber assembly protein | - |
| NL737_RS09680 | 2019146..2019346 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 1992461..2035549 | 43088 | ||
| inside | Prophage | - | sopE2 | 1992461..2048475 | 56014 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251263 NZ_CP100732:2014369-2014472 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT251263 NZ_CP100732:c2014474-2014329 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG