Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2014329..2014474 Replicon chromosome
Accession NZ_CP100732
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain R18.1932

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2014369..2014472 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2014329..2014474 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
NL737_RS09600 2010755..2011453 - 699 WP_000944282.1 exodeoxyribonuclease X -
NL737_RS09605 2011477..2012133 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
NL737_RS09610 2012241..2012471 - 231 WP_000856224.1 DNA polymerase III subunit theta -
NL737_RS09615 2012609..2012983 + 375 WP_000168393.1 CopC domain-containing protein YobA -
NL737_RS09620 2012984..2013859 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
NL737_RS09625 2013876..2014229 + 354 WP_000722368.1 YebY family protein -
- 2014329..2014474 - 146 - - Antitoxin
- 2014369..2014472 + 104 - - Toxin
NL737_RS09630 2014603..2015526 - 924 Protein_1882 tyrosine-type recombinase/integrase -
NL737_RS09635 2015790..2016251 - 462 Protein_1883 DNA breaking-rejoining protein -
NL737_RS09640 2016240..2016431 + 192 Protein_1884 glycoside hydrolase family 19 protein -
NL737_RS09645 2016485..2017018 + 534 WP_001050882.1 DUF2514 domain-containing protein -
NL737_RS09650 2017275..2017442 - 168 WP_000789530.1 lytic enzyme -
NL737_RS09655 2017507..2017695 - 189 WP_001521334.1 hypothetical protein -
NL737_RS09660 2017750..2018010 + 261 Protein_1888 DUF1441 family protein -
NL737_RS09665 2018012..2018227 + 216 Protein_1889 shikimate transporter -
NL737_RS09670 2018225..2018569 + 345 Protein_1890 macro domain-containing protein -
NL737_RS09675 2018579..2019049 + 471 Protein_1891 tail fiber assembly protein -
NL737_RS09680 2019146..2019346 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 1992461..2035549 43088
inside Prophage - sopE2 1992461..2048475 56014


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T251263 NZ_CP100732:2014369-2014472 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT251263 NZ_CP100732:c2014474-2014329 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References