Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2104790..2104935 Replicon chromosome
Accession NZ_CP110198
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain 1104-75

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2104830..2104933 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2104790..2104935 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
OCK70_RS10200 2101216..2101914 - 699 WP_000944282.1 exodeoxyribonuclease X -
OCK70_RS10205 2101938..2102594 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
OCK70_RS10210 2102702..2102932 - 231 WP_000856224.1 DNA polymerase III subunit theta -
OCK70_RS10215 2103070..2103444 + 375 WP_000168393.1 CopC domain-containing protein YobA -
OCK70_RS10220 2103445..2104320 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
OCK70_RS10225 2104337..2104690 + 354 WP_000722368.1 YebY family protein -
- 2104790..2104935 - 146 - - Antitoxin
- 2104830..2104933 + 104 - - Toxin
OCK70_RS10230 2105064..2105987 - 924 Protein_2000 tyrosine-type recombinase/integrase -
OCK70_RS10235 2106251..2106712 - 462 Protein_2001 DNA breaking-rejoining protein -
OCK70_RS10240 2106701..2106892 + 192 Protein_2002 glycoside hydrolase family 19 protein -
OCK70_RS10245 2106946..2107479 + 534 WP_001050882.1 DUF2514 domain-containing protein -
OCK70_RS10250 2107736..2107903 - 168 WP_000789530.1 lytic enzyme -
OCK70_RS10255 2107968..2108156 - 189 WP_001521334.1 hypothetical protein -
OCK70_RS10260 2108211..2108471 + 261 Protein_2006 DUF1441 family protein -
OCK70_RS10265 2108686..2109030 + 345 Protein_2007 macro domain-containing protein -
OCK70_RS10270 2109040..2109510 + 471 Protein_2008 tail fiber assembly protein -
OCK70_RS10275 2109607..2109807 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2082922..2129792 46870


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T263395 NZ_CP110198:2104830-2104933 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT263395 NZ_CP110198:c2104935-2104790 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References