Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2044855..2045000 | Replicon | chromosome |
Accession | NZ_CP117338 | ||
Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain RM095 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2044895..2044998 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2044855..2045000 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PQP94_RS09820 | 2041281..2041979 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
PQP94_RS09825 | 2042003..2042659 | - | 657 | WP_274895937.1 | carbon-nitrogen hydrolase family protein | - |
PQP94_RS09830 | 2042767..2042997 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
PQP94_RS09835 | 2043135..2043509 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
PQP94_RS09840 | 2043510..2044385 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
PQP94_RS09845 | 2044402..2044755 | + | 354 | WP_000722368.1 | YebY family protein | - |
- | 2044855..2045000 | - | 146 | - | - | Antitoxin |
- | 2044895..2044998 | + | 104 | - | - | Toxin |
PQP94_RS09850 | 2045129..2046052 | - | 924 | Protein_1924 | tyrosine-type recombinase/integrase | - |
PQP94_RS09855 | 2046316..2046777 | - | 462 | Protein_1925 | DNA breaking-rejoining protein | - |
PQP94_RS09860 | 2046766..2046957 | + | 192 | Protein_1926 | glycoside hydrolase family 19 protein | - |
PQP94_RS09865 | 2047011..2047544 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
PQP94_RS09870 | 2047801..2047968 | - | 168 | WP_000789530.1 | lytic enzyme | - |
PQP94_RS09875 | 2048033..2048221 | - | 189 | WP_001521334.1 | hypothetical protein | - |
PQP94_RS09880 | 2048276..2048536 | + | 261 | Protein_1930 | DUF1441 family protein | - |
PQP94_RS09885 | 2048751..2049095 | + | 345 | Protein_1931 | macro domain-containing protein | - |
PQP94_RS09890 | 2049105..2049575 | + | 471 | Protein_1932 | tail fiber assembly protein | - |
PQP94_RS09895 | 2049672..2049872 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
inside | Prophage | - | sopE2 | 2022987..2069848 | 46861 | ||
inside | Prophage | - | sopE2 | 2022987..2077503 | 54516 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270612 NZ_CP117338:2044895-2044998 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT270612 NZ_CP117338:c2045000-2044855 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG