Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2044855..2045000 Replicon chromosome
Accession NZ_CP117338
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain RM095

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2044895..2044998 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2044855..2045000 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
PQP94_RS09820 2041281..2041979 - 699 WP_000944282.1 exodeoxyribonuclease X -
PQP94_RS09825 2042003..2042659 - 657 WP_274895937.1 carbon-nitrogen hydrolase family protein -
PQP94_RS09830 2042767..2042997 - 231 WP_000856224.1 DNA polymerase III subunit theta -
PQP94_RS09835 2043135..2043509 + 375 WP_000168393.1 CopC domain-containing protein YobA -
PQP94_RS09840 2043510..2044385 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
PQP94_RS09845 2044402..2044755 + 354 WP_000722368.1 YebY family protein -
- 2044855..2045000 - 146 - - Antitoxin
- 2044895..2044998 + 104 - - Toxin
PQP94_RS09850 2045129..2046052 - 924 Protein_1924 tyrosine-type recombinase/integrase -
PQP94_RS09855 2046316..2046777 - 462 Protein_1925 DNA breaking-rejoining protein -
PQP94_RS09860 2046766..2046957 + 192 Protein_1926 glycoside hydrolase family 19 protein -
PQP94_RS09865 2047011..2047544 + 534 WP_001050882.1 DUF2514 domain-containing protein -
PQP94_RS09870 2047801..2047968 - 168 WP_000789530.1 lytic enzyme -
PQP94_RS09875 2048033..2048221 - 189 WP_001521334.1 hypothetical protein -
PQP94_RS09880 2048276..2048536 + 261 Protein_1930 DUF1441 family protein -
PQP94_RS09885 2048751..2049095 + 345 Protein_1931 macro domain-containing protein -
PQP94_RS09890 2049105..2049575 + 471 Protein_1932 tail fiber assembly protein -
PQP94_RS09895 2049672..2049872 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2022987..2069848 46861
inside Prophage - sopE2 2022987..2077503 54516


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T270612 NZ_CP117338:2044895-2044998 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT270612 NZ_CP117338:c2045000-2044855 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References