Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2014330..2014475 Replicon chromosome
Accession NZ_CP100739
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain R18.0292

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2014370..2014473 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2014330..2014475 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
NL736_RS09600 2010756..2011454 - 699 WP_000944282.1 exodeoxyribonuclease X -
NL736_RS09605 2011478..2012134 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
NL736_RS09610 2012242..2012472 - 231 WP_000856224.1 DNA polymerase III subunit theta -
NL736_RS09615 2012610..2012984 + 375 WP_000168393.1 CopC domain-containing protein YobA -
NL736_RS09620 2012985..2013860 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
NL736_RS09625 2013877..2014230 + 354 WP_000722368.1 YebY family protein -
- 2014330..2014475 - 146 - - Antitoxin
- 2014370..2014473 + 104 - - Toxin
NL736_RS09630 2014604..2015527 - 924 Protein_1882 tyrosine-type recombinase/integrase -
NL736_RS09635 2015791..2016252 - 462 Protein_1883 DNA breaking-rejoining protein -
NL736_RS09640 2016241..2016432 + 192 Protein_1884 glycoside hydrolase family 19 protein -
NL736_RS09645 2016486..2017019 + 534 WP_001050882.1 DUF2514 domain-containing protein -
NL736_RS09650 2017276..2017443 - 168 WP_000789530.1 lytic enzyme -
NL736_RS09655 2017508..2017696 - 189 WP_001521334.1 hypothetical protein -
NL736_RS09660 2017751..2018011 + 261 Protein_1888 DUF1441 family protein -
NL736_RS09665 2018013..2018228 + 216 Protein_1889 shikimate transporter -
NL736_RS09670 2018226..2018570 + 345 Protein_1890 macro domain-containing protein -
NL736_RS09675 2018580..2019050 + 471 Protein_1891 tail fiber assembly protein -
NL736_RS09680 2019147..2019347 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 1992462..2035550 43088
inside Prophage - sopE2 1992462..2048476 56014


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T251307 NZ_CP100739:2014370-2014473 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT251307 NZ_CP100739:c2014475-2014330 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References