Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2014330..2014475 | Replicon | chromosome |
| Accession | NZ_CP100739 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain R18.0292 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2014370..2014473 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2014330..2014475 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NL736_RS09600 | 2010756..2011454 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NL736_RS09605 | 2011478..2012134 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| NL736_RS09610 | 2012242..2012472 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NL736_RS09615 | 2012610..2012984 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NL736_RS09620 | 2012985..2013860 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| NL736_RS09625 | 2013877..2014230 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2014330..2014475 | - | 146 | - | - | Antitoxin |
| - | 2014370..2014473 | + | 104 | - | - | Toxin |
| NL736_RS09630 | 2014604..2015527 | - | 924 | Protein_1882 | tyrosine-type recombinase/integrase | - |
| NL736_RS09635 | 2015791..2016252 | - | 462 | Protein_1883 | DNA breaking-rejoining protein | - |
| NL736_RS09640 | 2016241..2016432 | + | 192 | Protein_1884 | glycoside hydrolase family 19 protein | - |
| NL736_RS09645 | 2016486..2017019 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| NL736_RS09650 | 2017276..2017443 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NL736_RS09655 | 2017508..2017696 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| NL736_RS09660 | 2017751..2018011 | + | 261 | Protein_1888 | DUF1441 family protein | - |
| NL736_RS09665 | 2018013..2018228 | + | 216 | Protein_1889 | shikimate transporter | - |
| NL736_RS09670 | 2018226..2018570 | + | 345 | Protein_1890 | macro domain-containing protein | - |
| NL736_RS09675 | 2018580..2019050 | + | 471 | Protein_1891 | tail fiber assembly protein | - |
| NL736_RS09680 | 2019147..2019347 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 1992462..2035550 | 43088 | ||
| inside | Prophage | - | sopE2 | 1992462..2048476 | 56014 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251307 NZ_CP100739:2014370-2014473 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT251307 NZ_CP100739:c2014475-2014330 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG