Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2854701..2854846 Replicon chromosome
Accession NZ_CP047542
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10330

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2854703..2854806 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2854701..2854846 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
DXN30_RS13930 2849829..2850029 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
DXN30_RS13935 2850126..2850596 - 471 Protein_2708 tail fiber assembly protein -
DXN30_RS13940 2850606..2850950 - 345 Protein_2709 macro domain-containing protein -
DXN30_RS13945 2851165..2851425 - 261 Protein_2710 DUF1441 family protein -
DXN30_RS13950 2851480..2851668 + 189 WP_001521334.1 hypothetical protein -
DXN30_RS13955 2851733..2851900 + 168 WP_000789530.1 lytic enzyme -
DXN30_RS13960 2852157..2852690 - 534 WP_001050882.1 DUF2514 domain-containing protein -
DXN30_RS13965 2852744..2852935 - 192 Protein_2714 glycoside hydrolase family 19 protein -
DXN30_RS13970 2852924..2853385 + 462 Protein_2715 DNA breaking-rejoining protein -
DXN30_RS13975 2853649..2854572 + 924 Protein_2716 tyrosine-type recombinase/integrase -
- 2854701..2854846 + 146 - - Antitoxin
- 2854703..2854806 - 104 - - Toxin
DXN30_RS13980 2854946..2855299 - 354 WP_000722368.1 YebY family protein -
DXN30_RS13985 2855316..2856191 - 876 WP_000979702.1 copper homeostasis membrane protein CopD -
DXN30_RS13990 2856192..2856566 - 375 WP_000168393.1 CopC domain-containing protein YobA -
DXN30_RS13995 2856704..2856934 + 231 WP_000856224.1 DNA polymerase III subunit theta -
DXN30_RS14000 2857042..2857698 + 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
DXN30_RS14005 2857722..2858420 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2829844..2876714 46870


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T146547 NZ_CP047542:c2854806-2854703 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT146547 NZ_CP047542:2854701-2854846 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References