Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2854701..2854846 | Replicon | chromosome |
| Accession | NZ_CP047542 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10330 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2854703..2854806 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2854701..2854846 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DXN30_RS13930 | 2849829..2850029 | + | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
| DXN30_RS13935 | 2850126..2850596 | - | 471 | Protein_2708 | tail fiber assembly protein | - |
| DXN30_RS13940 | 2850606..2850950 | - | 345 | Protein_2709 | macro domain-containing protein | - |
| DXN30_RS13945 | 2851165..2851425 | - | 261 | Protein_2710 | DUF1441 family protein | - |
| DXN30_RS13950 | 2851480..2851668 | + | 189 | WP_001521334.1 | hypothetical protein | - |
| DXN30_RS13955 | 2851733..2851900 | + | 168 | WP_000789530.1 | lytic enzyme | - |
| DXN30_RS13960 | 2852157..2852690 | - | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| DXN30_RS13965 | 2852744..2852935 | - | 192 | Protein_2714 | glycoside hydrolase family 19 protein | - |
| DXN30_RS13970 | 2852924..2853385 | + | 462 | Protein_2715 | DNA breaking-rejoining protein | - |
| DXN30_RS13975 | 2853649..2854572 | + | 924 | Protein_2716 | tyrosine-type recombinase/integrase | - |
| - | 2854701..2854846 | + | 146 | - | - | Antitoxin |
| - | 2854703..2854806 | - | 104 | - | - | Toxin |
| DXN30_RS13980 | 2854946..2855299 | - | 354 | WP_000722368.1 | YebY family protein | - |
| DXN30_RS13985 | 2855316..2856191 | - | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| DXN30_RS13990 | 2856192..2856566 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| DXN30_RS13995 | 2856704..2856934 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| DXN30_RS14000 | 2857042..2857698 | + | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| DXN30_RS14005 | 2857722..2858420 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2829844..2876714 | 46870 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T146547 NZ_CP047542:c2854806-2854703 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT146547 NZ_CP047542:2854701-2854846 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG