Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2124503..2124648 Replicon chromosome
Accession NZ_CP117357
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain RM096

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2124543..2124646 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2124503..2124648 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
PQQ15_RS10385 2120929..2121627 - 699 WP_274882848.1 exodeoxyribonuclease X -
PQQ15_RS10390 2121678..2122307 - 630 WP_054175300.1 carbon-nitrogen hydrolase family protein -
PQQ15_RS10395 2122415..2122645 - 231 WP_000856224.1 DNA polymerase III subunit theta -
PQQ15_RS10400 2122783..2123157 + 375 WP_274882852.1 CopC domain-containing protein YobA -
PQQ15_RS10405 2123158..2124033 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
PQQ15_RS10410 2124050..2124403 + 354 WP_000722368.1 YebY family protein -
- 2124503..2124648 - 146 - - Antitoxin
- 2124543..2124646 + 104 - - Toxin
PQQ15_RS10415 2124777..2125700 - 924 Protein_2036 tyrosine-type recombinase/integrase -
PQQ15_RS10420 2125964..2126425 - 462 Protein_2037 DNA breaking-rejoining protein -
PQQ15_RS10425 2126414..2126605 + 192 Protein_2038 glycoside hydrolase family 19 protein -
PQQ15_RS10430 2126659..2127192 + 534 WP_001050882.1 DUF2514 domain-containing protein -
PQQ15_RS10435 2127449..2127616 - 168 WP_000789530.1 lytic enzyme -
PQQ15_RS10440 2127681..2127869 - 189 WP_001521334.1 hypothetical protein -
PQQ15_RS10445 2127924..2128184 + 261 Protein_2042 DUF1441 family protein -
PQQ15_RS10450 2128399..2128743 + 345 Protein_2043 macro domain-containing protein -
PQQ15_RS10455 2128753..2129223 + 471 Protein_2044 tail fiber assembly protein -
PQQ15_RS10460 2129320..2129520 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2102635..2144225 41590


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T270768 NZ_CP117357:2124543-2124646 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT270768 NZ_CP117357:c2124648-2124503 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References