Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2124503..2124648 | Replicon | chromosome |
| Accession | NZ_CP117357 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain RM096 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2124543..2124646 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2124503..2124648 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PQQ15_RS10385 | 2120929..2121627 | - | 699 | WP_274882848.1 | exodeoxyribonuclease X | - |
| PQQ15_RS10390 | 2121678..2122307 | - | 630 | WP_054175300.1 | carbon-nitrogen hydrolase family protein | - |
| PQQ15_RS10395 | 2122415..2122645 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| PQQ15_RS10400 | 2122783..2123157 | + | 375 | WP_274882852.1 | CopC domain-containing protein YobA | - |
| PQQ15_RS10405 | 2123158..2124033 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| PQQ15_RS10410 | 2124050..2124403 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2124503..2124648 | - | 146 | - | - | Antitoxin |
| - | 2124543..2124646 | + | 104 | - | - | Toxin |
| PQQ15_RS10415 | 2124777..2125700 | - | 924 | Protein_2036 | tyrosine-type recombinase/integrase | - |
| PQQ15_RS10420 | 2125964..2126425 | - | 462 | Protein_2037 | DNA breaking-rejoining protein | - |
| PQQ15_RS10425 | 2126414..2126605 | + | 192 | Protein_2038 | glycoside hydrolase family 19 protein | - |
| PQQ15_RS10430 | 2126659..2127192 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| PQQ15_RS10435 | 2127449..2127616 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| PQQ15_RS10440 | 2127681..2127869 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| PQQ15_RS10445 | 2127924..2128184 | + | 261 | Protein_2042 | DUF1441 family protein | - |
| PQQ15_RS10450 | 2128399..2128743 | + | 345 | Protein_2043 | macro domain-containing protein | - |
| PQQ15_RS10455 | 2128753..2129223 | + | 471 | Protein_2044 | tail fiber assembly protein | - |
| PQQ15_RS10460 | 2129320..2129520 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2102635..2144225 | 41590 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270768 NZ_CP117357:2124543-2124646 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT270768 NZ_CP117357:c2124648-2124503 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
