Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2165700..2165845 | Replicon | chromosome |
| Accession | NZ_CP075372 | ||
| Organism | Salmonella enterica strain no75 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2165740..2165843 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2165700..2165845 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KH432_RS10590 | 2162126..2162824 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| KH432_RS10595 | 2162848..2163504 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| KH432_RS10600 | 2163612..2163842 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| KH432_RS10605 | 2163980..2164354 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| KH432_RS10610 | 2164355..2165230 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| KH432_RS10615 | 2165247..2165600 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2165700..2165845 | - | 146 | - | - | Antitoxin |
| - | 2165740..2165843 | + | 104 | - | - | Toxin |
| KH432_RS10620 | 2165974..2166897 | - | 924 | Protein_2091 | tyrosine-type recombinase/integrase | - |
| KH432_RS26180 | 2167161..2167622 | - | 462 | Protein_2092 | DNA breaking-rejoining protein | - |
| KH432_RS10630 | 2167611..2167802 | + | 192 | Protein_2093 | glycoside hydrolase family 19 protein | - |
| KH432_RS10635 | 2167856..2168389 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| KH432_RS10640 | 2168646..2168813 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| KH432_RS10645 | 2168878..2169066 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| KH432_RS10650 | 2169121..2169381 | + | 261 | Protein_2097 | DUF1441 family protein | - |
| KH432_RS10655 | 2169596..2169940 | + | 345 | Protein_2098 | macro domain-containing protein | - |
| KH432_RS10660 | 2169950..2170420 | + | 471 | Protein_2099 | tail fiber assembly protein | - |
| KH432_RS10665 | 2170517..2170717 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2142760..2188040 | 45280 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T203515 NZ_CP075372:2165740-2165843 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT203515 NZ_CP075372:c2165845-2165700 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG