Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2165700..2165845 Replicon chromosome
Accession NZ_CP075372
Organism Salmonella enterica strain no75

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2165740..2165843 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2165700..2165845 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
KH432_RS10590 2162126..2162824 - 699 WP_000944282.1 exodeoxyribonuclease X -
KH432_RS10595 2162848..2163504 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
KH432_RS10600 2163612..2163842 - 231 WP_000856224.1 DNA polymerase III subunit theta -
KH432_RS10605 2163980..2164354 + 375 WP_000168393.1 CopC domain-containing protein YobA -
KH432_RS10610 2164355..2165230 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
KH432_RS10615 2165247..2165600 + 354 WP_000722368.1 YebY family protein -
- 2165700..2165845 - 146 - - Antitoxin
- 2165740..2165843 + 104 - - Toxin
KH432_RS10620 2165974..2166897 - 924 Protein_2091 tyrosine-type recombinase/integrase -
KH432_RS26180 2167161..2167622 - 462 Protein_2092 DNA breaking-rejoining protein -
KH432_RS10630 2167611..2167802 + 192 Protein_2093 glycoside hydrolase family 19 protein -
KH432_RS10635 2167856..2168389 + 534 WP_001050882.1 DUF2514 domain-containing protein -
KH432_RS10640 2168646..2168813 - 168 WP_000789530.1 lytic enzyme -
KH432_RS10645 2168878..2169066 - 189 WP_001521334.1 hypothetical protein -
KH432_RS10650 2169121..2169381 + 261 Protein_2097 DUF1441 family protein -
KH432_RS10655 2169596..2169940 + 345 Protein_2098 macro domain-containing protein -
KH432_RS10660 2169950..2170420 + 471 Protein_2099 tail fiber assembly protein -
KH432_RS10665 2170517..2170717 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2142760..2188040 45280


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T203515 NZ_CP075372:2165740-2165843 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT203515 NZ_CP075372:c2165845-2165700 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References