Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2853363..2853508 Replicon chromosome
Accession NZ_CP047548
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10169

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2853365..2853468 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2853363..2853508 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
DXN26_RS13925 2848491..2848691 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
DXN26_RS13930 2848788..2849258 - 471 Protein_2707 tail fiber assembly protein -
DXN26_RS13935 2849268..2849612 - 345 Protein_2708 macro domain-containing protein -
DXN26_RS13940 2849827..2850087 - 261 Protein_2709 DUF1441 family protein -
DXN26_RS13945 2850142..2850330 + 189 WP_001521334.1 hypothetical protein -
DXN26_RS13950 2850395..2850562 + 168 WP_000789530.1 lytic enzyme -
DXN26_RS13955 2850819..2851352 - 534 WP_001050882.1 DUF2514 domain-containing protein -
DXN26_RS13960 2851406..2851597 - 192 Protein_2713 glycoside hydrolase family 19 protein -
DXN26_RS13965 2851586..2852047 + 462 Protein_2714 DNA breaking-rejoining protein -
DXN26_RS13970 2852311..2853234 + 924 Protein_2715 tyrosine-type recombinase/integrase -
- 2853363..2853508 + 146 - - Antitoxin
- 2853365..2853468 - 104 - - Toxin
DXN26_RS13975 2853608..2853961 - 354 WP_000722368.1 YebY family protein -
DXN26_RS13980 2853978..2854853 - 876 WP_000979702.1 copper homeostasis membrane protein CopD -
DXN26_RS13985 2854854..2855228 - 375 WP_000168393.1 CopC domain-containing protein YobA -
DXN26_RS13990 2855366..2855596 + 231 WP_000856224.1 DNA polymerase III subunit theta -
DXN26_RS13995 2855704..2856360 + 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
DXN26_RS14000 2856384..2857082 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2831168..2875376 44208


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T146622 NZ_CP047548:c2853468-2853365 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT146622 NZ_CP047548:2853363-2853508 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References