Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2693526..2693671 Replicon chromosome
Accession NZ_CP113536
Organism Salmonella enterica strain ZCX

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2693528..2693631 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2693526..2693671 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
OXV07_RS13215 2688654..2688854 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
OXV07_RS13220 2688951..2689421 - 471 Protein_2589 tail fiber assembly protein -
OXV07_RS13225 2689431..2689775 - 345 Protein_2590 macro domain-containing protein -
OXV07_RS13230 2689990..2690250 - 261 Protein_2591 DUF1441 family protein -
OXV07_RS13235 2690305..2690493 + 189 WP_001521334.1 hypothetical protein -
OXV07_RS13240 2690558..2690725 + 168 WP_000789530.1 lytic enzyme -
OXV07_RS13245 2690982..2691515 - 534 WP_001050882.1 DUF2514 domain-containing protein -
OXV07_RS13250 2691569..2691760 - 192 Protein_2595 glycoside hydrolase family 19 protein -
OXV07_RS13255 2691749..2692210 + 462 Protein_2596 DNA breaking-rejoining protein -
OXV07_RS13260 2692474..2693397 + 924 Protein_2597 tyrosine-type recombinase/integrase -
- 2693526..2693671 + 146 - - Antitoxin
- 2693528..2693631 - 104 - - Toxin
OXV07_RS13265 2693771..2694124 - 354 WP_000722368.1 YebY family protein -
OXV07_RS13270 2694141..2695016 - 876 WP_000979702.1 copper homeostasis membrane protein CopD -
OXV07_RS13275 2695017..2695391 - 375 WP_000168393.1 CopC domain-containing protein YobA -
OXV07_RS13280 2695529..2695759 + 231 WP_000856224.1 DNA polymerase III subunit theta -
OXV07_RS13285 2695867..2696523 + 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
OXV07_RS13290 2696547..2697245 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2673948..2715539 41591


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T265923 NZ_CP113536:c2693631-2693528 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT265923 NZ_CP113536:2693526-2693671 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References