Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2693526..2693671 | Replicon | chromosome |
| Accession | NZ_CP113536 | ||
| Organism | Salmonella enterica strain ZCX | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2693528..2693631 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2693526..2693671 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| OXV07_RS13215 | 2688654..2688854 | + | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
| OXV07_RS13220 | 2688951..2689421 | - | 471 | Protein_2589 | tail fiber assembly protein | - |
| OXV07_RS13225 | 2689431..2689775 | - | 345 | Protein_2590 | macro domain-containing protein | - |
| OXV07_RS13230 | 2689990..2690250 | - | 261 | Protein_2591 | DUF1441 family protein | - |
| OXV07_RS13235 | 2690305..2690493 | + | 189 | WP_001521334.1 | hypothetical protein | - |
| OXV07_RS13240 | 2690558..2690725 | + | 168 | WP_000789530.1 | lytic enzyme | - |
| OXV07_RS13245 | 2690982..2691515 | - | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| OXV07_RS13250 | 2691569..2691760 | - | 192 | Protein_2595 | glycoside hydrolase family 19 protein | - |
| OXV07_RS13255 | 2691749..2692210 | + | 462 | Protein_2596 | DNA breaking-rejoining protein | - |
| OXV07_RS13260 | 2692474..2693397 | + | 924 | Protein_2597 | tyrosine-type recombinase/integrase | - |
| - | 2693526..2693671 | + | 146 | - | - | Antitoxin |
| - | 2693528..2693631 | - | 104 | - | - | Toxin |
| OXV07_RS13265 | 2693771..2694124 | - | 354 | WP_000722368.1 | YebY family protein | - |
| OXV07_RS13270 | 2694141..2695016 | - | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| OXV07_RS13275 | 2695017..2695391 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| OXV07_RS13280 | 2695529..2695759 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| OXV07_RS13285 | 2695867..2696523 | + | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| OXV07_RS13290 | 2696547..2697245 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2673948..2715539 | 41591 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T265923 NZ_CP113536:c2693631-2693528 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT265923 NZ_CP113536:2693526-2693671 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
