Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2185730..2185875 | Replicon | chromosome |
| Accession | NZ_CP091544 | ||
| Organism | Salmonella enterica strain 1618 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2185770..2185873 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2185730..2185875 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| L4414_RS10750 | 2182156..2182854 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| L4414_RS10755 | 2182878..2183534 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| L4414_RS10760 | 2183642..2183872 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| L4414_RS10765 | 2184010..2184384 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| L4414_RS10770 | 2184385..2185260 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| L4414_RS10775 | 2185277..2185630 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2185730..2185875 | - | 146 | - | - | Antitoxin |
| - | 2185770..2185873 | + | 104 | - | - | Toxin |
| L4414_RS10780 | 2186004..2186927 | - | 924 | Protein_2115 | tyrosine-type recombinase/integrase | - |
| L4414_RS10785 | 2187191..2187652 | - | 462 | Protein_2116 | DNA breaking-rejoining protein | - |
| L4414_RS10790 | 2187641..2187832 | + | 192 | Protein_2117 | glycoside hydrolase family 19 protein | - |
| L4414_RS10795 | 2187886..2188419 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| L4414_RS10800 | 2188676..2188843 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| L4414_RS10805 | 2188908..2189096 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| L4414_RS10810 | 2189151..2189411 | + | 261 | Protein_2121 | DUF1441 family protein | - |
| L4414_RS10815 | 2189626..2189970 | + | 345 | Protein_2122 | macro domain-containing protein | - |
| L4414_RS10820 | 2189980..2190450 | + | 471 | Protein_2123 | tail fiber assembly protein | - |
| L4414_RS10825 | 2190547..2190747 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2163862..2203455 | 39593 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T233629 NZ_CP091544:2185770-2185873 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT233629 NZ_CP091544:c2185875-2185730 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
