Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2185730..2185875 Replicon chromosome
Accession NZ_CP091544
Organism Salmonella enterica strain 1618

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2185770..2185873 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2185730..2185875 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
L4414_RS10750 2182156..2182854 - 699 WP_000944282.1 exodeoxyribonuclease X -
L4414_RS10755 2182878..2183534 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
L4414_RS10760 2183642..2183872 - 231 WP_000856224.1 DNA polymerase III subunit theta -
L4414_RS10765 2184010..2184384 + 375 WP_000168393.1 CopC domain-containing protein YobA -
L4414_RS10770 2184385..2185260 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
L4414_RS10775 2185277..2185630 + 354 WP_000722368.1 YebY family protein -
- 2185730..2185875 - 146 - - Antitoxin
- 2185770..2185873 + 104 - - Toxin
L4414_RS10780 2186004..2186927 - 924 Protein_2115 tyrosine-type recombinase/integrase -
L4414_RS10785 2187191..2187652 - 462 Protein_2116 DNA breaking-rejoining protein -
L4414_RS10790 2187641..2187832 + 192 Protein_2117 glycoside hydrolase family 19 protein -
L4414_RS10795 2187886..2188419 + 534 WP_001050882.1 DUF2514 domain-containing protein -
L4414_RS10800 2188676..2188843 - 168 WP_000789530.1 lytic enzyme -
L4414_RS10805 2188908..2189096 - 189 WP_001521334.1 hypothetical protein -
L4414_RS10810 2189151..2189411 + 261 Protein_2121 DUF1441 family protein -
L4414_RS10815 2189626..2189970 + 345 Protein_2122 macro domain-containing protein -
L4414_RS10820 2189980..2190450 + 471 Protein_2123 tail fiber assembly protein -
L4414_RS10825 2190547..2190747 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2163862..2203455 39593


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T233629 NZ_CP091544:2185770-2185873 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT233629 NZ_CP091544:c2185875-2185730 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References