Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2764519..2764664 | Replicon | chromosome |
| Accession | NZ_CP101375 | ||
| Organism | Salmonella enterica strain SC2016090 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2764559..2764662 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2764519..2764664 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NMU33_RS13640 | 2760945..2761643 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NMU33_RS13645 | 2761667..2762323 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| NMU33_RS13650 | 2762431..2762661 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NMU33_RS13655 | 2762799..2763173 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NMU33_RS13660 | 2763174..2764049 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| NMU33_RS13665 | 2764066..2764419 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2764519..2764664 | - | 146 | - | - | Antitoxin |
| - | 2764559..2764662 | + | 104 | - | - | Toxin |
| NMU33_RS13670 | 2764793..2765716 | - | 924 | Protein_2669 | tyrosine-type recombinase/integrase | - |
| NMU33_RS13675 | 2765980..2766441 | - | 462 | Protein_2670 | DNA breaking-rejoining protein | - |
| NMU33_RS13680 | 2766430..2766621 | + | 192 | Protein_2671 | glycoside hydrolase family 19 protein | - |
| NMU33_RS13685 | 2766675..2767208 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| NMU33_RS13690 | 2767465..2767632 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NMU33_RS13695 | 2767697..2767885 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| NMU33_RS13700 | 2767940..2768200 | + | 261 | Protein_2675 | DUF1441 family protein | - |
| NMU33_RS13705 | 2768415..2768759 | + | 345 | Protein_2676 | macro domain-containing protein | - |
| NMU33_RS13710 | 2768769..2769239 | + | 471 | Protein_2677 | tail fiber assembly protein | - |
| NMU33_RS13715 | 2769336..2769563 | - | 228 | WP_010989049.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2742651..2784250 | 41599 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251996 NZ_CP101375:2764559-2764662 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT251996 NZ_CP101375:c2764664-2764519 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG