Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2764519..2764664 Replicon chromosome
Accession NZ_CP101375
Organism Salmonella enterica strain SC2016090

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2764559..2764662 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2764519..2764664 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
NMU33_RS13640 2760945..2761643 - 699 WP_000944282.1 exodeoxyribonuclease X -
NMU33_RS13645 2761667..2762323 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
NMU33_RS13650 2762431..2762661 - 231 WP_000856224.1 DNA polymerase III subunit theta -
NMU33_RS13655 2762799..2763173 + 375 WP_000168393.1 CopC domain-containing protein YobA -
NMU33_RS13660 2763174..2764049 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
NMU33_RS13665 2764066..2764419 + 354 WP_000722368.1 YebY family protein -
- 2764519..2764664 - 146 - - Antitoxin
- 2764559..2764662 + 104 - - Toxin
NMU33_RS13670 2764793..2765716 - 924 Protein_2669 tyrosine-type recombinase/integrase -
NMU33_RS13675 2765980..2766441 - 462 Protein_2670 DNA breaking-rejoining protein -
NMU33_RS13680 2766430..2766621 + 192 Protein_2671 glycoside hydrolase family 19 protein -
NMU33_RS13685 2766675..2767208 + 534 WP_001050882.1 DUF2514 domain-containing protein -
NMU33_RS13690 2767465..2767632 - 168 WP_000789530.1 lytic enzyme -
NMU33_RS13695 2767697..2767885 - 189 WP_001521334.1 hypothetical protein -
NMU33_RS13700 2767940..2768200 + 261 Protein_2675 DUF1441 family protein -
NMU33_RS13705 2768415..2768759 + 345 Protein_2676 macro domain-containing protein -
NMU33_RS13710 2768769..2769239 + 471 Protein_2677 tail fiber assembly protein -
NMU33_RS13715 2769336..2769563 - 228 WP_010989049.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2742651..2784250 41599


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T251996 NZ_CP101375:2764559-2764662 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT251996 NZ_CP101375:c2764664-2764519 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References