Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 214802..214947 Replicon chromosome
Accession NZ_CP098741
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain HJL222

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 214804..214907 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 214802..214947 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
NCG87_RS01100 209930..210130 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
NCG87_RS01105 210227..210697 - 471 Protein_214 tail fiber assembly protein -
NCG87_RS01110 210707..211051 - 345 Protein_215 macro domain-containing protein -
NCG87_RS01115 211266..211526 - 261 Protein_216 DUF1441 family protein -
NCG87_RS01120 211581..211769 + 189 WP_001521334.1 hypothetical protein -
NCG87_RS01125 211834..212001 + 168 WP_000789530.1 lytic enzyme -
NCG87_RS01130 212258..212791 - 534 WP_001050882.1 DUF2514 domain-containing protein -
NCG87_RS01135 212845..213036 - 192 Protein_220 glycoside hydrolase family 19 protein -
NCG87_RS01140 213025..213486 + 462 Protein_221 DNA breaking-rejoining protein -
NCG87_RS01145 213750..214673 + 924 Protein_222 tyrosine-type recombinase/integrase -
- 214802..214947 + 146 - - Antitoxin
- 214804..214907 - 104 - - Toxin
NCG87_RS01150 215047..215400 - 354 WP_000722368.1 YebY family protein -
NCG87_RS01155 215417..216292 - 876 WP_000979702.1 copper homeostasis membrane protein CopD -
NCG87_RS01160 216293..216667 - 375 WP_000168393.1 CopC domain-containing protein YobA -
NCG87_RS01165 216805..217035 + 231 WP_000856224.1 DNA polymerase III subunit theta -
NCG87_RS01170 217143..217799 + 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
NCG87_RS01175 217823..218521 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 189953..236815 46862


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T247945 NZ_CP098741:c214907-214804 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT247945 NZ_CP098741:214802-214947 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References