Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2854838..2854983 Replicon chromosome
Accession NZ_CP047527
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10648

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2854840..2854943 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2854838..2854983 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
DXN11_RS13925 2849966..2850166 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
DXN11_RS13930 2850263..2850733 - 471 Protein_2707 tail fiber assembly protein -
DXN11_RS13935 2850743..2851087 - 345 Protein_2708 macro domain-containing protein -
DXN11_RS13940 2851302..2851562 - 261 Protein_2709 DUF1441 family protein -
DXN11_RS13945 2851617..2851805 + 189 WP_001521334.1 hypothetical protein -
DXN11_RS13950 2851870..2852037 + 168 WP_000789530.1 lytic enzyme -
DXN11_RS13955 2852294..2852827 - 534 WP_001050882.1 DUF2514 domain-containing protein -
DXN11_RS13960 2852881..2853072 - 192 Protein_2713 glycoside hydrolase family 19 protein -
DXN11_RS13965 2853061..2853522 + 462 Protein_2714 DNA breaking-rejoining protein -
DXN11_RS13970 2853786..2854709 + 924 Protein_2715 tyrosine-type recombinase/integrase -
- 2854838..2854983 + 146 - - Antitoxin
- 2854840..2854943 - 104 - - Toxin
DXN11_RS13975 2855083..2855436 - 354 WP_000722368.1 YebY family protein -
DXN11_RS13980 2855453..2856328 - 876 WP_000979702.1 copper homeostasis membrane protein CopD -
DXN11_RS13985 2856329..2856703 - 375 WP_000168393.1 CopC domain-containing protein YobA -
DXN11_RS13990 2856841..2857071 + 231 WP_000856224.1 DNA polymerase III subunit theta -
DXN11_RS13995 2857179..2857835 + 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
DXN11_RS14000 2857859..2858557 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2829981..2876851 46870


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T146392 NZ_CP047527:c2854943-2854840 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT146392 NZ_CP047527:2854838-2854983 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References