Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2555234..2555379 | Replicon | chromosome |
| Accession | NZ_CP091554 | ||
| Organism | Salmonella enterica strain 751 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2555236..2555339 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2555234..2555379 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| INN81_RS12370 | 2550362..2550562 | + | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
| INN81_RS12375 | 2550659..2551129 | - | 471 | Protein_2413 | tail fiber assembly protein | - |
| INN81_RS12380 | 2551139..2551483 | - | 345 | Protein_2414 | macro domain-containing protein | - |
| INN81_RS12385 | 2551698..2551958 | - | 261 | Protein_2415 | DUF1441 family protein | - |
| INN81_RS12390 | 2552013..2552201 | + | 189 | WP_001521334.1 | hypothetical protein | - |
| INN81_RS12395 | 2552266..2552433 | + | 168 | WP_000789530.1 | lytic enzyme | - |
| INN81_RS12400 | 2552690..2553223 | - | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| INN81_RS12405 | 2553277..2553468 | - | 192 | Protein_2419 | glycoside hydrolase family 19 protein | - |
| INN81_RS12410 | 2553457..2553918 | + | 462 | Protein_2420 | DNA breaking-rejoining protein | - |
| INN81_RS12415 | 2554182..2555105 | + | 924 | Protein_2421 | tyrosine-type recombinase/integrase | - |
| - | 2555234..2555379 | + | 146 | - | - | Antitoxin |
| - | 2555236..2555339 | - | 104 | - | - | Toxin |
| INN81_RS12420 | 2555479..2555832 | - | 354 | WP_000722368.1 | YebY family protein | - |
| INN81_RS12425 | 2555849..2556724 | - | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| INN81_RS12430 | 2556725..2557099 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| INN81_RS12435 | 2557237..2557467 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| INN81_RS12440 | 2557575..2558231 | + | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| INN81_RS12445 | 2558255..2558953 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2530377..2577247 | 46870 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T233681 NZ_CP091554:c2555339-2555236 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT233681 NZ_CP091554:2555234-2555379 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
