Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2114845..2114990 | Replicon | chromosome |
| Accession | NZ_CP091560 | ||
| Organism | Salmonella enterica strain 179 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2114885..2114988 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2114845..2114990 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| INN78_RS10400 | 2111271..2111969 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| INN78_RS10405 | 2111993..2112649 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| INN78_RS10410 | 2112757..2112987 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| INN78_RS10415 | 2113125..2113499 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| INN78_RS10420 | 2113500..2114375 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| INN78_RS10425 | 2114392..2114745 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2114845..2114990 | - | 146 | - | - | Antitoxin |
| - | 2114885..2114988 | + | 104 | - | - | Toxin |
| INN78_RS10430 | 2115119..2116042 | - | 924 | Protein_2044 | tyrosine-type recombinase/integrase | - |
| INN78_RS10435 | 2116306..2116767 | - | 462 | Protein_2045 | DNA breaking-rejoining protein | - |
| INN78_RS10440 | 2116756..2116947 | + | 192 | Protein_2046 | glycoside hydrolase family 19 protein | - |
| INN78_RS10445 | 2117001..2117534 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| INN78_RS10450 | 2117791..2117958 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| INN78_RS10455 | 2118023..2118211 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| INN78_RS10460 | 2118266..2118526 | + | 261 | Protein_2050 | DUF1441 family protein | - |
| INN78_RS10465 | 2118741..2119085 | + | 345 | Protein_2051 | macro domain-containing protein | - |
| INN78_RS10470 | 2119095..2119565 | + | 471 | Protein_2052 | tail fiber assembly protein | - |
| INN78_RS10475 | 2119662..2119862 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2092977..2139847 | 46870 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T233754 NZ_CP091560:2114885-2114988 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT233754 NZ_CP091560:c2114990-2114845 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG