Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2114845..2114990 Replicon chromosome
Accession NZ_CP091560
Organism Salmonella enterica strain 179

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2114885..2114988 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2114845..2114990 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
INN78_RS10400 2111271..2111969 - 699 WP_000944282.1 exodeoxyribonuclease X -
INN78_RS10405 2111993..2112649 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
INN78_RS10410 2112757..2112987 - 231 WP_000856224.1 DNA polymerase III subunit theta -
INN78_RS10415 2113125..2113499 + 375 WP_000168393.1 CopC domain-containing protein YobA -
INN78_RS10420 2113500..2114375 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
INN78_RS10425 2114392..2114745 + 354 WP_000722368.1 YebY family protein -
- 2114845..2114990 - 146 - - Antitoxin
- 2114885..2114988 + 104 - - Toxin
INN78_RS10430 2115119..2116042 - 924 Protein_2044 tyrosine-type recombinase/integrase -
INN78_RS10435 2116306..2116767 - 462 Protein_2045 DNA breaking-rejoining protein -
INN78_RS10440 2116756..2116947 + 192 Protein_2046 glycoside hydrolase family 19 protein -
INN78_RS10445 2117001..2117534 + 534 WP_001050882.1 DUF2514 domain-containing protein -
INN78_RS10450 2117791..2117958 - 168 WP_000789530.1 lytic enzyme -
INN78_RS10455 2118023..2118211 - 189 WP_001521334.1 hypothetical protein -
INN78_RS10460 2118266..2118526 + 261 Protein_2050 DUF1441 family protein -
INN78_RS10465 2118741..2119085 + 345 Protein_2051 macro domain-containing protein -
INN78_RS10470 2119095..2119565 + 471 Protein_2052 tail fiber assembly protein -
INN78_RS10475 2119662..2119862 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2092977..2139847 46870


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T233754 NZ_CP091560:2114885-2114988 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT233754 NZ_CP091560:c2114990-2114845 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References