Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2186361..2186506 | Replicon | chromosome |
| Accession | NZ_CP101390 | ||
| Organism | Salmonella enterica strain SC2017297 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2186401..2186504 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2186361..2186506 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NMU39_RS10755 | 2182787..2183485 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NMU39_RS10760 | 2183509..2184165 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| NMU39_RS10765 | 2184273..2184503 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NMU39_RS10770 | 2184641..2185015 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NMU39_RS10775 | 2185016..2185891 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| NMU39_RS10780 | 2185908..2186261 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2186361..2186506 | - | 146 | - | - | Antitoxin |
| - | 2186401..2186504 | + | 104 | - | - | Toxin |
| NMU39_RS10785 | 2186635..2187558 | - | 924 | Protein_2111 | tyrosine-type recombinase/integrase | - |
| NMU39_RS10790 | 2187822..2188283 | - | 462 | Protein_2112 | DNA breaking-rejoining protein | - |
| NMU39_RS10795 | 2188272..2188463 | + | 192 | Protein_2113 | glycoside hydrolase family 19 protein | - |
| NMU39_RS10800 | 2188517..2189050 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| NMU39_RS10805 | 2189307..2189474 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NMU39_RS10810 | 2189539..2189727 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| NMU39_RS10815 | 2189782..2190042 | + | 261 | Protein_2117 | DUF1441 family protein | - |
| NMU39_RS10820 | 2190257..2190601 | + | 345 | Protein_2118 | macro domain-containing protein | - |
| NMU39_RS10825 | 2190611..2191081 | + | 471 | Protein_2119 | tail fiber assembly protein | - |
| NMU39_RS10830 | 2191178..2191405 | - | 228 | WP_010989049.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2166364..2206092 | 39728 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T252119 NZ_CP101390:2186401-2186504 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT252119 NZ_CP101390:c2186506-2186361 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG