Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2186361..2186506 Replicon chromosome
Accession NZ_CP101390
Organism Salmonella enterica strain SC2017297

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2186401..2186504 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2186361..2186506 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
NMU39_RS10755 2182787..2183485 - 699 WP_000944282.1 exodeoxyribonuclease X -
NMU39_RS10760 2183509..2184165 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
NMU39_RS10765 2184273..2184503 - 231 WP_000856224.1 DNA polymerase III subunit theta -
NMU39_RS10770 2184641..2185015 + 375 WP_000168393.1 CopC domain-containing protein YobA -
NMU39_RS10775 2185016..2185891 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
NMU39_RS10780 2185908..2186261 + 354 WP_000722368.1 YebY family protein -
- 2186361..2186506 - 146 - - Antitoxin
- 2186401..2186504 + 104 - - Toxin
NMU39_RS10785 2186635..2187558 - 924 Protein_2111 tyrosine-type recombinase/integrase -
NMU39_RS10790 2187822..2188283 - 462 Protein_2112 DNA breaking-rejoining protein -
NMU39_RS10795 2188272..2188463 + 192 Protein_2113 glycoside hydrolase family 19 protein -
NMU39_RS10800 2188517..2189050 + 534 WP_001050882.1 DUF2514 domain-containing protein -
NMU39_RS10805 2189307..2189474 - 168 WP_000789530.1 lytic enzyme -
NMU39_RS10810 2189539..2189727 - 189 WP_001521334.1 hypothetical protein -
NMU39_RS10815 2189782..2190042 + 261 Protein_2117 DUF1441 family protein -
NMU39_RS10820 2190257..2190601 + 345 Protein_2118 macro domain-containing protein -
NMU39_RS10825 2190611..2191081 + 471 Protein_2119 tail fiber assembly protein -
NMU39_RS10830 2191178..2191405 - 228 WP_010989049.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2166364..2206092 39728


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T252119 NZ_CP101390:2186401-2186504 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT252119 NZ_CP101390:c2186506-2186361 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References