Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2146061..2146206 | Replicon | chromosome |
| Accession | NZ_CP047525 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF11077 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2146101..2146204 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2146061..2146206 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DXN14_RS10505 | 2142487..2143185 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| DXN14_RS10510 | 2143209..2143865 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| DXN14_RS10515 | 2143973..2144203 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| DXN14_RS10520 | 2144341..2144715 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| DXN14_RS10525 | 2144716..2145591 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| DXN14_RS10530 | 2145608..2145961 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2146061..2146206 | - | 146 | - | - | Antitoxin |
| - | 2146101..2146204 | + | 104 | - | - | Toxin |
| DXN14_RS10535 | 2146335..2147258 | - | 924 | Protein_2067 | tyrosine-type recombinase/integrase | - |
| DXN14_RS10540 | 2147522..2147983 | - | 462 | Protein_2068 | DNA breaking-rejoining protein | - |
| DXN14_RS10545 | 2147972..2148163 | + | 192 | Protein_2069 | glycoside hydrolase family 19 protein | - |
| DXN14_RS10550 | 2148217..2148750 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| DXN14_RS10555 | 2149007..2149174 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| DXN14_RS10560 | 2149239..2149427 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| DXN14_RS10565 | 2149482..2149742 | + | 261 | Protein_2073 | DUF1441 family protein | - |
| DXN14_RS10570 | 2149957..2150301 | + | 345 | Protein_2074 | macro domain-containing protein | - |
| DXN14_RS10575 | 2150311..2150781 | + | 471 | Protein_2075 | tail fiber assembly protein | - |
| DXN14_RS10580 | 2150878..2151078 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2126064..2168401 | 42337 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T146363 NZ_CP047525:2146101-2146204 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT146363 NZ_CP047525:c2146206-2146061 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG