Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2126211..2126356 | Replicon | chromosome |
| Accession | NZ_CP090535 | ||
| Organism | Salmonella enterica strain 2016089-SE | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2126251..2126354 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2126211..2126356 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| L0F58_RS10375 | 2122637..2123335 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| L0F58_RS10380 | 2123359..2124015 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| L0F58_RS10385 | 2124123..2124353 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| L0F58_RS10390 | 2124491..2124865 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| L0F58_RS10395 | 2124866..2125741 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| L0F58_RS10400 | 2125758..2126111 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2126211..2126356 | - | 146 | - | - | Antitoxin |
| - | 2126251..2126354 | + | 104 | - | - | Toxin |
| L0F58_RS10405 | 2126485..2127408 | - | 924 | Protein_2038 | tyrosine-type recombinase/integrase | - |
| L0F58_RS10410 | 2127672..2128133 | - | 462 | Protein_2039 | DNA breaking-rejoining protein | - |
| L0F58_RS10415 | 2128122..2128313 | + | 192 | Protein_2040 | glycoside hydrolase family 19 protein | - |
| L0F58_RS10420 | 2128367..2128900 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| L0F58_RS10425 | 2129157..2129324 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| L0F58_RS10430 | 2129389..2129577 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| L0F58_RS10435 | 2129632..2129892 | + | 261 | Protein_2044 | DUF1441 family protein | - |
| L0F58_RS10440 | 2130107..2130451 | + | 345 | Protein_2045 | macro domain-containing protein | - |
| L0F58_RS10445 | 2130461..2130931 | + | 471 | Protein_2046 | tail fiber assembly protein | - |
| L0F58_RS10450 | 2131028..2131228 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2106214..2148551 | 42337 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T231073 NZ_CP090535:2126251-2126354 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT231073 NZ_CP090535:c2126356-2126211 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
