Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2774227..2774372 Replicon chromosome
Accession NZ_CP047537
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain SJTUF10405

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2774229..2774332 (-)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2774227..2774372 (+)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
DXN32_RS13540 2769355..2769555 + 201 WP_010989029.1 PagK family vesicle-borne virulence factor -
DXN32_RS13545 2769652..2770122 - 471 Protein_2633 tail fiber assembly protein -
DXN32_RS13550 2770132..2770476 - 345 Protein_2634 macro domain-containing protein -
DXN32_RS13555 2770691..2770951 - 261 Protein_2635 DUF1441 family protein -
DXN32_RS13560 2771006..2771194 + 189 WP_001521334.1 hypothetical protein -
DXN32_RS13565 2771259..2771426 + 168 WP_000789530.1 lytic enzyme -
DXN32_RS13570 2771683..2772216 - 534 WP_001050882.1 DUF2514 domain-containing protein -
DXN32_RS13575 2772270..2772461 - 192 Protein_2639 glycoside hydrolase family 19 protein -
DXN32_RS13580 2772450..2772911 + 462 Protein_2640 DNA breaking-rejoining protein -
DXN32_RS13585 2773175..2774098 + 924 Protein_2641 tyrosine-type recombinase/integrase -
- 2774227..2774372 + 146 - - Antitoxin
- 2774229..2774332 - 104 - - Toxin
DXN32_RS13590 2774472..2774825 - 354 WP_000722368.1 YebY family protein -
DXN32_RS13595 2774842..2775717 - 876 WP_000979702.1 copper homeostasis membrane protein CopD -
DXN32_RS13600 2775718..2776092 - 375 WP_000168393.1 CopC domain-containing protein YobA -
DXN32_RS13605 2776230..2776460 + 231 WP_000856224.1 DNA polymerase III subunit theta -
DXN32_RS13610 2776568..2777224 + 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
DXN32_RS13615 2777248..2777946 + 699 WP_000944282.1 exodeoxyribonuclease X -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2749371..2796240 46869


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T146492 NZ_CP047537:c2774332-2774229 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT146492 NZ_CP047537:2774227-2774372 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References