Detailed information
Overview
| Name | pilA | Type | Machinery gene |
| Locus tag | M2I93_RS33685 | Genome accession | NZ_CP096946 |
| Coordinates | 5643451..5643537 (-) | Length | 28 a.a. |
| NCBI ID | WP_252645401.1 | Uniprot ID | - |
| Organism | Pseudomonas aeruginosa strain NY5530 | ||
| Function | assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Genomic island | 5623803..5642808 | 5643451..5643537 | flank | 643 |
Gene organization within MGE regions
Location: 5623803..5643537
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| M2I93_RS26420 (M2I93_26375) | - | 5623803..5625017 (+) | 1215 | WP_034069051.1 | site-specific integrase | - |
| M2I93_RS26425 (M2I93_26380) | - | 5625019..5625561 (-) | 543 | WP_123809552.1 | hypothetical protein | - |
| M2I93_RS26430 (M2I93_26385) | - | 5625705..5625905 (+) | 201 | WP_023082007.1 | helix-turn-helix domain-containing protein | - |
| M2I93_RS26435 (M2I93_26390) | - | 5625902..5626318 (+) | 417 | WP_034054964.1 | hypothetical protein | - |
| M2I93_RS26440 (M2I93_26395) | - | 5626311..5626544 (+) | 234 | WP_031653969.1 | hypothetical protein | - |
| M2I93_RS26445 (M2I93_26400) | - | 5626541..5626789 (+) | 249 | WP_031653970.1 | hypothetical protein | - |
| M2I93_RS26450 (M2I93_26405) | - | 5626786..5627091 (+) | 306 | WP_023109345.1 | hypothetical protein | - |
| M2I93_RS33680 | - | 5627094..5627531 (+) | 438 | WP_308416434.1 | hypothetical protein | - |
| M2I93_RS26460 (M2I93_26415) | - | 5627570..5628037 (+) | 468 | WP_031629313.1 | hypothetical protein | - |
| M2I93_RS26465 (M2I93_26420) | - | 5628044..5628997 (+) | 954 | WP_308416433.1 | DUF3631 domain-containing protein | - |
| M2I93_RS26470 (M2I93_26425) | - | 5628997..5629290 (+) | 294 | WP_221345446.1 | hypothetical protein | - |
| M2I93_RS26475 (M2I93_26430) | - | 5629346..5630242 (+) | 897 | WP_034069047.1 | hypothetical protein | - |
| M2I93_RS26480 (M2I93_26435) | - | 5630948..5632123 (+) | 1176 | WP_223822176.1 | DUF262 domain-containing protein | - |
| M2I93_RS26485 (M2I93_26440) | - | 5632134..5632961 (+) | 828 | WP_124157035.1 | MAE_28990/MAE_18760 family HEPN-like nuclease | - |
| M2I93_RS26490 (M2I93_26445) | - | 5634275..5634781 (-) | 507 | WP_034064628.1 | GNAT family N-acetyltransferase | - |
| M2I93_RS26495 (M2I93_26450) | - | 5635554..5635823 (+) | 270 | WP_225007575.1 | hypothetical protein | - |
| M2I93_RS26500 (M2I93_26455) | - | 5635823..5636059 (+) | 237 | WP_003096116.1 | hypothetical protein | - |
| M2I93_RS26505 (M2I93_26460) | - | 5636198..5636434 (-) | 237 | WP_071536299.1 | hypothetical protein | - |
| M2I93_RS26510 (M2I93_26465) | - | 5636462..5639224 (-) | 2763 | WP_057379627.1 | RHS repeat domain-containing protein | - |
| M2I93_RS26515 (M2I93_26470) | - | 5639239..5640387 (-) | 1149 | WP_172773772.1 | DUF6531 domain-containing protein | - |
| M2I93_RS26520 (M2I93_26475) | - | 5642566..5642808 (+) | 243 | WP_023109353.1 | hypothetical protein | - |
| M2I93_RS26530 (M2I93_26485) | pilA | 5643085..5643411 (-) | 327 | WP_349632734.1 | pilin | Machinery gene |
| M2I93_RS33685 (M2I93_26490) | pilA | 5643451..5643537 (-) | 87 | WP_252645401.1 | prepilin-type N-terminal cleavage/methylation domain-containing protein | Machinery gene |
Sequence
Protein
Download Length: 28 a.a. Molecular weight: 2938.75 Da Isoelectric Point: 8.9962
>NTDB_id=685550 M2I93_RS33685 WP_252645401.1 5643451..5643537(-) (pilA) [Pseudomonas aeruginosa strain NY5530]
MKAQKGFTLIELMIVVAIIGILAAIAIP
MKAQKGFTLIELMIVVAIIGILAAIAIP
Nucleotide
Download Length: 87 bp
>NTDB_id=685550 M2I93_RS33685 WP_252645401.1 5643451..5643537(-) (pilA) [Pseudomonas aeruginosa strain NY5530]
ATGAAAGCTCAAAAAGGCTTTACCTTGATCGAACTGATGATCGTGGTTGCGATCATCGGTATCCTGGCGGCAATTGCCAT
TCCCTAG
ATGAAAGCTCAAAAAGGCTTTACCTTGATCGAACTGATGATCGTGGTTGCGATCATCGGTATCCTGGCGGCAATTGCCAT
TCCCTAG
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.