Detailed information NTG0685550

Bioinformatically predicted

Overview

• Name: pilA
• Type: Machinery gene
• Locus tag: M2I93_RS33685
• Genome accession: NZ_CP096946
• Coordinates: 5643451..5643537 (-)
• Length: 28 a.a.
• NCBI ID: WP_252645401.1
• Uniprot ID: -
• Organism: Pseudomonas aeruginosa strain NY5530
• Function: assembly of type IV pilus (predicted from homology) DNA binding and uptake

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type	MGE coordinates	Gene coordinates	Relative position	Distance (bp)
Genomic island	5623803..5642808	5643451..5643537	flank	643

Gene organization within MGE regions

Location: 5623803..5643537

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
M2I93_RS26420 (M2I93_26375)	-	5623803..5625017 (+)	1215	WP_034069051.1	site-specific integrase	-
M2I93_RS26425 (M2I93_26380)	-	5625019..5625561 (-)	543	WP_123809552.1	hypothetical protein	-
M2I93_RS26430 (M2I93_26385)	-	5625705..5625905 (+)	201	WP_023082007.1	helix-turn-helix domain-containing protein	-
M2I93_RS26435 (M2I93_26390)	-	5625902..5626318 (+)	417	WP_034054964.1	hypothetical protein	-
M2I93_RS26440 (M2I93_26395)	-	5626311..5626544 (+)	234	WP_031653969.1	hypothetical protein	-
M2I93_RS26445 (M2I93_26400)	-	5626541..5626789 (+)	249	WP_031653970.1	hypothetical protein	-
M2I93_RS26450 (M2I93_26405)	-	5626786..5627091 (+)	306	WP_023109345.1	hypothetical protein	-
M2I93_RS33680	-	5627094..5627531 (+)	438	WP_308416434.1	hypothetical protein	-
M2I93_RS26460 (M2I93_26415)	-	5627570..5628037 (+)	468	WP_031629313.1	hypothetical protein	-
M2I93_RS26465 (M2I93_26420)	-	5628044..5628997 (+)	954	WP_308416433.1	DUF3631 domain-containing protein	-
M2I93_RS26470 (M2I93_26425)	-	5628997..5629290 (+)	294	WP_221345446.1	hypothetical protein	-
M2I93_RS26475 (M2I93_26430)	-	5629346..5630242 (+)	897	WP_034069047.1	hypothetical protein	-
M2I93_RS26480 (M2I93_26435)	-	5630948..5632123 (+)	1176	WP_223822176.1	DUF262 domain-containing protein	-
M2I93_RS26485 (M2I93_26440)	-	5632134..5632961 (+)	828	WP_124157035.1	MAE_28990/MAE_18760 family HEPN-like nuclease	-
M2I93_RS26490 (M2I93_26445)	-	5634275..5634781 (-)	507	WP_034064628.1	GNAT family N-acetyltransferase	-
M2I93_RS26495 (M2I93_26450)	-	5635554..5635823 (+)	270	WP_225007575.1	hypothetical protein	-
M2I93_RS26500 (M2I93_26455)	-	5635823..5636059 (+)	237	WP_003096116.1	hypothetical protein	-
M2I93_RS26505 (M2I93_26460)	-	5636198..5636434 (-)	237	WP_071536299.1	hypothetical protein	-
M2I93_RS26510 (M2I93_26465)	-	5636462..5639224 (-)	2763	WP_057379627.1	RHS repeat domain-containing protein	-
M2I93_RS26515 (M2I93_26470)	-	5639239..5640387 (-)	1149	WP_172773772.1	DUF6531 domain-containing protein	-
M2I93_RS26520 (M2I93_26475)	-	5642566..5642808 (+)	243	WP_023109353.1	hypothetical protein	-
M2I93_RS26530 (M2I93_26485)	pilA	5643085..5643411 (-)	327	WP_349632734.1	pilin	Machinery gene
M2I93_RS33685 (M2I93_26490)	pilA	5643451..5643537 (-)	87	WP_252645401.1	prepilin-type N-terminal cleavage/methylation domain-containing protein	Machinery gene

Sequence

Protein

• Length: 28 a.a.
• Molecular weight: 2938.75 Da
• Isoelectric Point: 8.9962

>NTDB_id=685550 M2I93_RS33685 WP_252645401.1 5643451..5643537(-) (pilA) [Pseudomonas aeruginosa strain NY5530]
MKAQKGFTLIELMIVVAIIGILAAIAIP

Nucleotide

• Length: 87 bp

>NTDB_id=685550 M2I93_RS33685 WP_252645401.1 5643451..5643537(-) (pilA) [Pseudomonas aeruginosa strain NY5530]
ATGAAAGCTCAAAAAGGCTTTACCTTGATCGAACTGATGATCGTGGTTGCGATCATCGGTATCCTGGCGGCAATTGCCAT
TCCCTAG

Domains

Predicted by InterproScan.

• Prokaryotic N-terminal methylation motif (N_methyl) (1-27)

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
pilA	Pseudomonas aeruginosa PAK	100	100	1
pilA	Vibrio cholerae C6706	88.889	96.429	0.857
pilA	Ralstonia pseudosolanacearum GMI1000	88.889	96.429	0.857
pilA	Vibrio cholerae strain A1552	88.889	96.429	0.857
pilA	Vibrio cholerae O1 biovar El Tor strain E7946	88.889	96.429	0.857
pilA	Vibrio campbellii strain DS40M4	85.714	100	0.857
pilA	Vibrio parahaemolyticus RIMD 2210633	82.143	100	0.821
pilE	Neisseria gonorrhoeae strain FA1090	84	89.286	0.75
pilE	Neisseria gonorrhoeae MS11	84	89.286	0.75
pilX	Neisseria meningitidis 8013	80	89.286	0.714
pilL	Neisseria gonorrhoeae MS11	80	89.286	0.714
pilV	Deinococcus radiodurans R1 = ATCC 13939 = DSM 20539	79.167	85.714	0.679
pilA/pilA1	Synechocystis sp. PCC 6803	70.37	96.429	0.679
pilY2	Acinetobacter baumannii D1279779	57.143	100	0.571
pilA/pilAI	Pseudomonas stutzeri DSM 10701	88.889	64.286	0.571
pilA	Acinetobacter baumannii strain A118	93.75	57.143	0.536
pilA	Acinetobacter nosocomialis M2	93.75	57.143	0.536
comP	Neisseria gonorrhoeae MS11	50	100	0.5
ctsG	Campylobacter jejuni subsp. jejuni 81-176	56	89.286	0.5
comP	Neisseria meningitidis 8013	50	100	0.5
comN	Haemophilus influenzae Rd KW20	56	89.286	0.5
pilV	Deinococcus radiodurans R1 = ATCC 13939 = DSM 20539	58.333	85.714	0.5
fimT	Acinetobacter baylyi ADP1	56.522	82.143	0.464
pilE	Legionella pneumophila strain ERS1305867	52	89.286	0.464
fimU	Acinetobacter baumannii D1279779	52	89.286	0.464
pilE	Legionella pneumophila str. Paris	52	89.286	0.464
pilA2	Legionella pneumophila str. Paris	100	46.429	0.464
pilA2	Legionella pneumophila strain ERS1305867	100	46.429	0.464
pilE	Neisseria elongata subsp. glycolytica ATCC 29315	92.857	50	0.464
comP	Acinetobacter baylyi ADP1	92.308	46.429	0.429
pilW	Acinetobacter baumannii D1279779	52.174	82.143	0.429
xcpV	Acinetobacter baumannii D1279779	52.174	82.143	0.429
comF	Acinetobacter baylyi ADP1	75	57.143	0.429
pilV	Neisseria gonorrhoeae MS11	42.308	92.857	0.393
pilV	Neisseria meningitidis 8013	42.308	92.857	0.393
pilI	Neisseria gonorrhoeae MS11	42.308	92.857	0.393
comGD	Latilactobacillus sakei subsp. sakei 23K	40.741	96.429	0.393
pilA/pilA1	Eikenella corrodens VA1	91.667	42.857	0.393
comYC	Streptococcus suis isolate S10	45.833	85.714	0.393