Detailed information NTG0379383

Bioinformatically predicted

Overview

• Name: pilA
• Type: Machinery gene
• Locus tag: GobsT_RS17770
• Genome accession: NZ_CP042911
• Coordinates: 4285680..4285778 (+)
• Length: 32 a.a.
• NCBI ID: WP_010040041.1
• Uniprot ID: -
• Organism: Gemmata obscuriglobus strain DSM 5831
• Function: type IV pilus biogenesis and function (predicted from homology) DNA binding and uptake

Genomic Context

Location: 4280680..4290778

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
GobsT_RS17755 (GobsT_36370)	-	4281334..4282431 (-)	1098	WP_010040034.1	PQQ-binding-like beta-propeller repeat protein	-
GobsT_RS17760 (GobsT_36380)	-	4282449..4283648 (-)	1200	WP_010040037.1	iron-containing alcohol dehydrogenase	-
GobsT_RS17765 (GobsT_36390)	-	4283575..4285011 (-)	1437	WP_010040039.1	aldehyde dehydrogenase family protein	-
GobsT_RS17770	pilA	4285680..4285778 (+)	99	WP_010040041.1	prepilin-type N-terminal cleavage/methylation domain-containing protein	Machinery gene
GobsT_RS17775 (GobsT_36400)	-	4286539..4288548 (-)	2010	WP_081471631.1	FG-GAP repeat domain-containing protein	-

Sequence

Protein

• Length: 32 a.a.
• Molecular weight: 3620.54 Da
• Isoelectric Point: 12.5000

>NTDB_id=379383 GobsT_RS17770 WP_010040041.1 4285680..4285778(+) (pilA) [Gemmata obscuriglobus strain DSM 5831]
MHRAARRGFTLIELLVVVAIIAVLLRLLFPAF

Nucleotide

• Length: 99 bp

>NTDB_id=379383 GobsT_RS17770 WP_010040041.1 4285680..4285778(+) (pilA) [Gemmata obscuriglobus strain DSM 5831]
ATGCATCGGGCCGCACGCCGCGGTTTCACGCTGATCGAGTTGCTGGTTGTGGTGGCCATAATCGCGGTGCTGCTCAGGTT
GCTATTCCCCGCCTTCTAA

Domains

Predicted by InterproScan.

• Prokaryotic N-terminal methylation motif (N_methyl) (4-25)

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
pilA/pilA1	Synechocystis sp. PCC 6803	60.714	87.5	0.531
pilA/pilAI	Pseudomonas stutzeri DSM 10701	50	100	0.5
pilA	Vibrio parahaemolyticus RIMD 2210633	59.259	84.375	0.5
pilA	Vibrio campbellii strain DS40M4	59.259	84.375	0.5
comF	Acinetobacter baylyi ADP1	55.556	84.375	0.469
pilA/pilA1	Eikenella corrodens VA1	46.875	100	0.469
pilV	Deinococcus radiodurans R1 = ATCC 13939 = DSM 20539	62.5	75	0.469
fimT	Acinetobacter baylyi ADP1	60	78.125	0.469
xcpW	Acinetobacter baumannii D1279779	60	78.125	0.469
pilA/pilAII	Pseudomonas stutzeri DSM 10701	50	93.75	0.469
pilE	Neisseria elongata subsp. glycolytica ATCC 29315	50	93.75	0.469
pilV	Deinococcus radiodurans R1 = ATCC 13939 = DSM 20539	53.571	87.5	0.469
comGC/cglC	Streptococcus pneumoniae TIGR4	46.667	93.75	0.438
comGC/cglC	Streptococcus pneumoniae Rx1	46.667	93.75	0.438
comGC/cglC	Streptococcus pneumoniae D39	46.667	93.75	0.438
comGC/cglC	Streptococcus pneumoniae R6	46.667	93.75	0.438
pilA	Vibrio cholerae O1 biovar El Tor strain E7946	51.852	84.375	0.438
pilA	Vibrio cholerae strain A1552	51.852	84.375	0.438
pilA	Vibrio cholerae C6706	51.852	84.375	0.438
pilA	Ralstonia pseudosolanacearum GMI1000	43.75	100	0.438
comGD	Latilactobacillus sakei subsp. sakei 23K	53.846	81.25	0.437
comYC	Streptococcus suis isolate S10	58.333	75	0.437
comYC	Streptococcus gordonii str. Challis substr. CH1	54.167	75	0.406
comP	Neisseria meningitidis 8013	50	81.25	0.406
comP	Neisseria gonorrhoeae MS11	50	81.25	0.406
pilE	Neisseria gonorrhoeae strain FA1090	48.148	84.375	0.406
pilE	Neisseria gonorrhoeae MS11	48.148	84.375	0.406
pilY2	Acinetobacter baumannii D1279779	46.154	81.25	0.375
pilA/pilA3	Thermus thermophilus HB27	60	62.5	0.375
fimT	Legionella pneumophila strain Lp02	48	78.125	0.375