Detailed information
Bioinformatically predicted
Overview
| Name | comEA | Type | Machinery gene |
| Locus tag | LLC_RS14370 | Genome accession | NZ_AP024222 |
| Coordinates | 2240443..2240544 (+) | Length | 33 a.a. |
| NCBI ID | WP_228764031.1 | Uniprot ID | A0AAJ6MIY4 |
| Organism | Lactococcus cremoris strain EPSC | ||
| Function | dsDNA binding to the cell surface (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| ICE | 2203963..2283334 | 2240443..2240544 | within | 0 |
Gene organization within MGE regions
Location: 2203963..2283334
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LLC_RS11290 (LLC_23280) | - | 2205437..2206975 (-) | 1539 | Protein_2232 | M13-type metalloendopeptidase | - |
| LLC_RS11295 (LLC_23290) | - | 2207132..2207806 (-) | 675 | WP_015082761.1 | helix-turn-helix domain-containing protein | - |
| LLC_RS11300 (LLC_23300) | - | 2208042..2208641 (+) | 600 | WP_011676808.1 | transcriptional regulator | - |
| LLC_RS11305 (LLC_23310) | rpoB | 2208910..2212500 (+) | 3591 | WP_126354712.1 | DNA-directed RNA polymerase subunit beta | - |
| LLC_RS11310 (LLC_23320) | rpoC | 2212608..2216231 (+) | 3624 | WP_164717651.1 | DNA-directed RNA polymerase subunit beta' | - |
| LLC_RS11315 (LLC_23330) | - | 2216412..2217263 (+) | 852 | WP_308167263.1 | diacylglycerol/lipid kinase family protein | - |
| LLC_RS11320 (LLC_23340) | - | 2217409..2218095 (+) | 687 | WP_014572148.1 | amino acid ABC transporter permease | - |
| LLC_RS11325 (LLC_23350) | - | 2218095..2218829 (+) | 735 | WP_011676803.1 | amino acid ABC transporter ATP-binding protein | - |
| LLC_RS11330 (LLC_23360) | mecA | 2218958..2219659 (+) | 702 | WP_011676802.1 | adaptor protein MecA | Regulator |
| LLC_RS11335 (LLC_23370) | - | 2219662..2220987 (+) | 1326 | WP_126354714.1 | glycosyltransferase family 4 protein | - |
| LLC_RS11340 (LLC_23380) | sufC | 2221163..2221933 (+) | 771 | WP_011676800.1 | Fe-S cluster assembly ATPase SufC | - |
| LLC_RS11345 (LLC_23390) | sufD | 2222073..2223329 (+) | 1257 | WP_021165660.1 | Fe-S cluster assembly protein SufD | - |
| LLC_RS11350 (LLC_23400) | - | 2223329..2224549 (+) | 1221 | WP_021213770.1 | cysteine desulfurase | - |
| LLC_RS11355 (LLC_23410) | - | 2224551..2225033 (+) | 483 | WP_031286519.1 | hypothetical protein | - |
| LLC_RS11360 (LLC_23420) | sufU | 2225167..2225625 (+) | 459 | WP_011676796.1 | Fe-S cluster assembly sulfur transfer protein SufU | - |
| LLC_RS11365 (LLC_23430) | sufB | 2225721..2227133 (+) | 1413 | WP_004255207.1 | Fe-S cluster assembly protein SufB | - |
| LLC_RS11370 (LLC_23440) | - | 2227480..2227770 (+) | 291 | WP_011676794.1 | WXG100 family type VII secretion target | - |
| LLC_RS11375 (LLC_23450) | essA | 2227878..2228348 (+) | 471 | WP_011835707.1 | type VII secretion protein EssA | - |
| LLC_RS11380 (LLC_23460) | - | 2228470..2228715 (+) | 246 | WP_021165657.1 | hypothetical protein | - |
| LLC_RS11385 (LLC_23470) | esaA | 2228778..2230778 (+) | 2001 | WP_061777933.1 | type VII secretion protein EsaA | - |
| LLC_RS11390 (LLC_23480) | - | 2230779..2231669 (-) | 891 | WP_061777934.1 | IS982 family transposase | - |
| LLC_RS11395 (LLC_23490) | - | 2231880..2232449 (+) | 570 | WP_011676781.1 | biotin transporter BioY | - |
| LLC_RS11400 (LLC_23500) | - | 2232455..2233426 (+) | 972 | WP_015082750.1 | biotin--[acetyl-CoA-carboxylase] ligase | - |
| LLC_RS11405 (LLC_23510) | - | 2233447..2233749 (+) | 303 | WP_011676779.1 | CHY zinc finger protein | - |
| LLC_RS11410 (LLC_23520) | tenA | 2233968..2234624 (+) | 657 | WP_011835701.1 | thiaminase II | - |
| LLC_RS11415 (LLC_23530) | - | 2235012..2236190 (+) | 1179 | WP_011676777.1 | SLC13 family permease | - |
| LLC_RS11420 (LLC_23540) | - | 2236363..2236923 (+) | 561 | WP_032950467.1 | GNAT family N-acetyltransferase | - |
| LLC_RS11425 | - | 2237039..2237437 (+) | 399 | WP_061777935.1 | hypothetical protein | - |
| LLC_RS11430 (LLC_23550) | - | 2237543..2238475 (+) | 933 | WP_014572202.1 | ABC transporter ATP-binding protein | - |
| LLC_RS11435 (LLC_23560) | - | 2238472..2239833 (+) | 1362 | WP_061777936.1 | ABC transporter permease | - |
| LLC_RS11440 (LLC_23570) | comEA | 2239964..2240446 (+) | 483 | WP_232035111.1 | SLBB domain-containing protein | Machinery gene |
| LLC_RS14370 | comEA | 2240443..2240544 (+) | 102 | WP_228764031.1 | ComEA family DNA-binding protein | Machinery gene |
| LLC_RS11445 (LLC_23580) | comEC | 2240672..2241943 (+) | 1272 | WP_324187043.1 | ComEC/Rec2 family competence protein | Machinery gene |
| LLC_RS14375 (LLC_23590) | comEC | 2241940..2242449 (+) | 510 | WP_232035112.1 | MBL fold metallo-hydrolase | Machinery gene |
| LLC_RS11450 (LLC_23600) | - | 2242526..2243416 (+) | 891 | WP_126354716.1 | IS982-like element IS982B family transposase | - |
| LLC_RS11455 (LLC_23610) | - | 2243437..2243742 (+) | 306 | Protein_2267 | ComEC/Rec2 family competence protein | - |
| LLC_RS11460 (LLC_23620) | - | 2244026..2244802 (+) | 777 | WP_061778314.1 | alpha/beta hydrolase | - |
| LLC_RS11465 (LLC_23630) | - | 2244985..2245200 (+) | 216 | WP_014572212.1 | F0F1 ATP synthase subunit C | - |
| LLC_RS11470 (LLC_23640) | atpB | 2245247..2245960 (+) | 714 | WP_004255255.1 | F0F1 ATP synthase subunit A | - |
| LLC_RS11475 (LLC_23650) | atpF | 2245975..2246481 (+) | 507 | WP_010906128.1 | F0F1 ATP synthase subunit B | - |
| LLC_RS11480 (LLC_23660) | - | 2246483..2247010 (+) | 528 | WP_014572213.1 | F0F1 ATP synthase subunit delta | - |
| LLC_RS11485 (LLC_23670) | atpA | 2247198..2248700 (+) | 1503 | WP_061778315.1 | F0F1 ATP synthase subunit alpha | - |
| LLC_RS11490 (LLC_23680) | - | 2248716..2249585 (+) | 870 | WP_021165644.1 | F0F1 ATP synthase subunit gamma | - |
| LLC_RS11495 (LLC_23690) | atpD | 2249757..2251166 (+) | 1410 | WP_021165643.1 | F0F1 ATP synthase subunit beta | - |
| LLC_RS11500 (LLC_23700) | - | 2251351..2251776 (+) | 426 | WP_011676764.1 | F0F1 ATP synthase subunit epsilon | - |
| LLC_RS11505 (LLC_23710) | - | 2251880..2252539 (+) | 660 | WP_231099776.1 | hypothetical protein | - |
| LLC_RS11510 (LLC_23720) | - | 2252540..2253067 (+) | 528 | WP_232035113.1 | hypothetical protein | - |
| LLC_RS14380 (LLC_23730) | - | 2253080..2253478 (+) | 399 | WP_232035114.1 | hypothetical protein | - |
| LLC_RS11515 (LLC_23750) | - | 2253515..2254626 (+) | 1112 | WP_126354718.1 | IS3-like element IS981 family transposase | - |
| LLC_RS11520 (LLC_23760) | - | 2254719..2254931 (+) | 213 | WP_234922798.1 | hypothetical protein | - |
| LLC_RS11525 (LLC_23770) | - | 2255039..2255587 (+) | 549 | WP_061777789.1 | hypothetical protein | - |
| LLC_RS11530 (LLC_23780) | - | 2255644..2256387 (-) | 744 | WP_011676756.1 | amino acid ABC transporter ATP-binding protein | - |
| LLC_RS11535 (LLC_23790) | - | 2256410..2258554 (-) | 2145 | WP_011676755.1 | amino acid ABC transporter substrate-binding protein/permease | - |
| LLC_RS11540 (LLC_23800) | - | 2258923..2259579 (+) | 657 | WP_014572220.1 | VTT domain-containing protein | - |
| LLC_RS11545 (LLC_23810) | - | 2259757..2260617 (+) | 861 | WP_021165626.1 | shikimate dehydrogenase | - |
| LLC_RS11550 (LLC_23820) | aroB | 2260614..2261684 (+) | 1071 | WP_061777788.1 | 3-dehydroquinate synthase | - |
| LLC_RS11555 (LLC_23830) | - | 2261798..2262721 (+) | 924 | WP_061777787.1 | DMT family transporter | - |
| LLC_RS11560 (LLC_23840) | - | 2263093..2263692 (+) | 600 | WP_014572223.1 | DUF1054 domain-containing protein | - |
| LLC_RS11565 (LLC_23850) | - | 2263697..2264293 (+) | 597 | WP_021165625.1 | HAD-IA family hydrolase | - |
| LLC_RS11570 (LLC_23860) | aroC | 2264324..2265490 (+) | 1167 | WP_011676748.1 | chorismate synthase | - |
| LLC_RS11575 (LLC_23870) | - | 2265612..2265968 (+) | 357 | WP_061777786.1 | YxeA family protein | - |
| LLC_RS11580 (LLC_23890) | - | 2266163..2266942 (+) | 780 | WP_021165624.1 | ABC transporter ATP-binding protein | - |
| LLC_RS11585 (LLC_23900) | - | 2266935..2268944 (+) | 2010 | WP_032950486.1 | ABC transporter permease | - |
| LLC_RS11590 (LLC_23910) | - | 2268965..2269912 (-) | 948 | WP_003130410.1 | IS30 family transposase | - |
| LLC_RS11595 (LLC_23920) | - | 2270211..2271275 (+) | 1065 | WP_011676743.1 | VanZ family protein | - |
| LLC_RS11600 (LLC_23930) | - | 2271278..2271949 (+) | 672 | WP_021165622.1 | response regulator transcription factor | - |
| LLC_RS14610 | - | 2271936..2272810 (+) | 875 | Protein_2298 | sensor histidine kinase | - |
| LLC_RS11610 (LLC_23960) | - | 2272814..2273878 (+) | 1065 | WP_011676740.1 | prephenate dehydrogenase | - |
| LLC_RS11615 (LLC_23970) | aroA | 2273999..2275291 (+) | 1293 | WP_126354722.1 | 3-phosphoshikimate 1-carboxyvinyltransferase | - |
| LLC_RS11620 (LLC_23980) | - | 2275315..2275803 (+) | 489 | WP_011676738.1 | shikimate kinase | - |
| LLC_RS11625 (LLC_23990) | pheA | 2275805..2276644 (+) | 840 | WP_011676737.1 | prephenate dehydratase | - |
| LLC_RS11630 (LLC_24000) | - | 2276647..2277240 (+) | 594 | WP_061777784.1 | histidine phosphatase family protein | - |
| LLC_RS11635 (LLC_24010) | - | 2277237..2279738 (+) | 2502 | WP_126354724.1 | ATP-dependent RecD-like DNA helicase | - |
| LLC_RS11640 (LLC_24020) | rpsT | 2279832..2280065 (-) | 234 | WP_011676734.1 | 30S ribosomal protein S20 | - |
| LLC_RS11645 (LLC_24030) | - | 2280395..2280907 (+) | 513 | WP_061777782.1 | HD domain-containing protein | - |
| LLC_RS11650 (LLC_24040) | - | 2281087..2282001 (+) | 915 | WP_011676732.1 | diacylglycerol/lipid kinase family protein | - |
| LLC_RS11655 (LLC_24050) | - | 2282123..2283334 (-) | 1212 | WP_126354726.1 | tyrosine-type recombinase/integrase | - |
Sequence
Protein
Download Length: 33 a.a. Molecular weight: 3658.14 Da Isoelectric Point: 4.4911
>NTDB_id=84162 LLC_RS14370 WP_228764031.1 2240443..2240544(+) (comEA) [Lactococcus cremoris strain EPSC]
MKNGDFKSIEDLGKVSGFGDKTLEKLKDEISID
MKNGDFKSIEDLGKVSGFGDKTLEKLKDEISID
Nucleotide
Download Length: 102 bp
>NTDB_id=84162 LLC_RS14370 WP_228764031.1 2240443..2240544(+) (comEA) [Lactococcus cremoris strain EPSC]
ATGAAAAATGGTGACTTTAAATCAATAGAGGATTTGGGTAAAGTATCTGGCTTTGGGGATAAAACATTAGAAAAATTGAA
AGATGAGATTTCTATTGATTAA
ATGAAAAATGGTGACTTTAAATCAATAGAGGATTTGGGTAAAGTATCTGGCTTTGGGGATAAAACATTAGAAAAATTGAA
AGATGAGATTTCTATTGATTAA
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.