Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   NDK36_RS02140 Genome accession   NZ_CP098491
Coordinates   421096..421218 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain NB205     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 416096..426218
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NDK36_RS02125 (NDK36_02125) yclJ 417710..418393 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  NDK36_RS02130 (NDK36_02130) yclK 418380..419801 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  NDK36_RS02135 (NDK36_02135) rapC 419964..421112 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  NDK36_RS02140 (NDK36_02140) phrC 421096..421218 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NDK36_RS02145 (NDK36_02145) yczM 421317..421406 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NDK36_RS02150 (NDK36_02150) yczN 421488..421601 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  NDK36_RS02155 (NDK36_02155) thrD 421754..423118 (-) 1365 WP_014478832.1 aspartate kinase -
  NDK36_RS02160 (NDK36_02160) ceuB 423509..424459 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NDK36_RS02165 (NDK36_02165) yclO 424452..425399 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  NDK36_RS02170 (NDK36_02170) yclP 425393..426151 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=600024 NDK36_RS02140 WP_003224994.1 421096..421218(+) (phrC) [Bacillus subtilis strain NB205]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=600024 NDK36_RS02140 WP_003224994.1 421096..421218(+) (phrC) [Bacillus subtilis strain NB205]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1