Detailed information    

experimental Experimentally validated

Overview

Name   comC/blpC   Type   Regulator
Locus tag   SMU_RS08700 Genome accession   NC_004350
Coordinates   1795008..1795148 (+) Length   46 a.a.
NCBI ID   WP_002267610.1    Uniprot ID   Q99QI5
Organism   Streptococcus mutans UA159     
Function   binding to ComD; induce autophosphorylation of ComD; regulation of comX expression   
Competence regulation

Function

An homolog of the comCDE and blpCHR locus of S. pneumoniae, modulates competence and controls production of bacteriocin-like peptides. CSP is thought to bind to BlpH, resulting in activation and phosphorylation of BlpR. In contrast to ComRS inactivation, deletion of blpCHR do not completely abolish competence development in S. mutans in those growth conditions, and the impact on transformability is also largely strain-dependent. blpCHR also indirectly regulates comX expression.


Genomic Context

Location: 1790008..1800148
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  SMU_RS08675 (SMU.1906c) - 1790072..1790284 (-) 213 WP_002263744.1 Blp family class II bacteriocin -
  SMU_RS09970 (SMU.1908c) - 1790689..1790853 (-) 165 WP_002265308.1 hypothetical protein -
  SMU_RS10085 - 1791293..1791505 (+) 213 Protein_1688 IS3 family transposase -
  SMU_RS08680 (SMU.1909c) - 1791628..1792032 (-) 405 WP_002263912.1 hypothetical protein -
  SMU_RS08685 (SMU.1910c) - 1792179..1792598 (-) 420 WP_002263913.1 hypothetical protein -
  SMU_RS08690 (SMU.1913c) - 1793979..1794380 (-) 402 WP_002310604.1 hypothetical protein -
  SMU_RS08695 (SMU.1914c) cipB 1794511..1794741 (-) 231 WP_002265368.1 Blp family class II bacteriocin Regulator
  SMU_RS08700 (SMU.1915) comC/blpC 1795008..1795148 (+) 141 WP_002267610.1 ComC/BlpC family leader-containing pheromone/bacteriocin Regulator
  SMU_RS08705 (SMU.1916) comD/blpH 1795290..1796615 (-) 1326 WP_002262113.1 sensor histidine kinase Regulator
  SMU_RS08710 (SMU.1917) comE/blpR 1796612..1797364 (-) 753 WP_002262114.1 response regulator transcription factor Regulator
  SMU_RS08715 (SMU.1918) - 1797836..1798474 (-) 639 WP_002262115.1 VTT domain-containing protein -
  SMU_RS08720 (SMU.1919) - 1798521..1799147 (-) 627 WP_002262116.1 hypothetical protein -

Regulatory network

Positive effect      
Negative effect
Regulator Target Regulation
  comC/blpC comX/sigX positive effect
  comX/sigX late competence genes positive effect
  comX/sigX late competence genes positive effect
  scnR comX/sigX positive effect
  hdrR comX/sigX positive effect
  hdrR comR positive effect
  hdrM hdrR negative effect
  mecA comX/sigX negative effect
  clpC comX/sigX negative effect
  comR comX/sigX positive effect
  comR comS positive effect
  cipB comR positive effect
  XrpA comR negative effect
  clpP comX/sigX negative effect
  XrpA comX/sigX negative effect
  XrpA comS negative effect
  scnK comX/sigX positive effect
  comS comX/sigX positive effect
  comS comS positive effect
  oppD comS positive effect
  cipB comS positive effect
  comD/blpH comX/sigX positive effect
  comD/blpH comE/blpR positive effect
  vicR comD/blpH negative effect
  comE/blpR comD/blpH positive effect
  vicK comD/blpH negative effect
  comC/blpC comD/blpH positive effect
  vicK comX/sigX negative effect
  vicK comC/blpC negative effect
  vicK comE/blpR negative effect
  comE/blpR comX/sigX positive effect
  comE/blpR comC/blpC positive effect
  comE/blpR comA/nlmT positive effect
  comE/blpR comE/blpR positive effect
  comE/blpR comB/nlmE positive effect
  vicR comE/blpR negative effect
  scnC comX/sigX positive effect
  brsR comX/sigX positive effect
  brsM brsR negative effect
  cipB comX/sigX positive effect
  vicR comX/sigX negative effect
  vicR comC/blpC negative effect
  comA/nlmT comC/blpC positive effect
  comB/nlmE comC/blpC positive effect
  ciaH comC/blpC positive effect
  sepM comC/blpC positive effect

Sequence

Protein


Download         Length: 46 a.a.        Molecular weight: 5211.06 Da        Isoelectric Point: 10.4929

>NTDB_id=53 SMU_RS08700 WP_002267610.1 1795008..1795148(+) (comC/blpC) [Streptococcus mutans UA159]
MKKTLSLKNDFKEIKTDELEIIIGGSGSLSTFFRLFNRSFTQALGK

Nucleotide


Download         Length: 141 bp        

>NTDB_id=53 SMU_RS08700 WP_002267610.1 1795008..1795148(+) (comC/blpC) [Streptococcus mutans UA159]
ATGAAAAAAACACTATCATTAAAAAATGACTTTAAAGAAATTAAGACTGATGAATTAGAGATTATCATTGGCGGAAGCGG
AAGCCTATCAACATTTTTCCGGCTGTTTAACAGAAGTTTTACACAAGCTTTGGGAAAATAA

CSP

This gene is known to encode the precursor of competence stimulating peptide (CSP), which involves in competence development. The mature CSP sequence is displayed as below:

SGSLSTFFRLFNRSFTQA


Domains

Predicted by InterProScan.

COMC family (ComC)

(1-32)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  PDB 2I2J

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comC/comC1 Streptococcus pneumoniae Rx1

44.444

87.805

0.39
  comC/comC1 Streptococcus pneumoniae D39

44.444

87.805

0.39
  comC/comC1 Streptococcus pneumoniae G54

44.444

87.805

0.39
  comC/comC1 Streptococcus pneumoniae R6

44.444

87.805

0.39

Multiple sequence alignment    



References

[1] David C I Hung et al. (2011) Characterization of DNA binding sites of the ComE response regulator from Streptococcus mutans. Journal of Bacteriology 193(14):3642-52. [PMID: 21602345]
[2] Julie A Perry et al. (2009) Peptide alarmone signalling triggers an auto-active bacteriocin necessary for genetic competence. Molecular Microbiology 72(4):905-17. [PMID: 19400789]
[3] Lucja M Jarosz et al. (2009) Streptococcus mutans competence-stimulating peptide inhibits Candida albicans hypha formation. Eukaryotic Cell 8(11):1658-64. [PMID: 19717744]
[4] Elaine Allan et al. (2007) Genetic variation in comC, the gene encoding competence-stimulating peptide (CSP) in Streptococcus mutans. FEMS Microbiology Letters 268(1):47-51. [PMID: 17229063]
[5] Jens Kreth et al. (2007) The response regulator ComE in Streptococcus mutans functions both as a transcription activator of mutacin production and repressor of CSP biosynthesis. Microbiology (Reading, England) 153(Pt 6):1799-1807. [PMID: 17526837]
[6] Marcelo B Aspiras et al. (2004) ComX activity of Streptococcus mutans growing in biofilms. FEMS Microbiology Letters 238(1):167-74. [PMID: 15336418]
[7] Y H Li et al. (2001) Natural genetic transformation of Streptococcus mutans growing in biofilms. Journal of Bacteriology 183(3):897-908. [PMID: 11208787]