Detailed information    

experimental Experimentally validated

Overview


Name   comS   Type   Regulator
Locus tag   - Genome accession   NC_004350
Coordinates   62613..62663 (+) Length   17 a.a.
NCBI ID   - Uniprot ID   -
Organism   Streptococcus mutans UA159     
Function   activate transcription of comX; activate transcription of comS   
Competence regulation

Function


The ComS pre-peptide is exported and processed via an unknown mechanism into XIP. XIP is re-imported via oligopeptide permease (Opp) and binds ComR. The ComR/XIP complex binds upstream of comS and sigX at PComR-box sites. The alternative sigma factor, SigX, facilitates RNA polymerase (RNAP) binding at Pcin-box sites. Genes regulated by SigX include the DNA-uptake and transformasome machinery.


Genomic Context


Location: 57613..67663
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  SMU_RS00360 (SMU.58) - 57639..58934 (+) 1296 WP_002263397.1 hypothetical protein -
  SMU_RS00365 (SMU.59) purB 59244..60542 (+) 1299 WP_002263398.1 adenylosuccinate lyase -
  SMU_RS00370 (SMU.60) - 60562..61248 (+) 687 WP_002263399.1 DNA alkylation repair protein -
  SMU_RS00375 (SMU.61) comR 61631..62545 (+) 915 WP_002263400.1 helix-turn-helix domain-containing protein Regulator
  - comS 62613..62663 (+) 51 - - Regulator
  SMU_RS00380 (SMU.63c) - 63079..64920 (-) 1842 WP_002263401.1 carbohydrate-binding domain-containing protein -
  SMU_RS00385 (SMU.64) ruvB 65256..66251 (+) 996 WP_002263402.1 Holliday junction branch migration DNA helicase RuvB Machinery gene
  SMU_RS00390 (SMU.65) - 66289..66714 (+) 426 WP_002263403.1 low molecular weight protein-tyrosine-phosphatase -
  SMU_RS00395 (SMU.66) - 66779..67162 (+) 384 WP_011074470.1 membrane protein -

Regulatory network


Positive effect      
Negative effect
Regulator Target Regulation
  comS comS positive effect
  comS comX/sigX positive effect
  oppD comS positive effect
  comR comS positive effect
  cipB comS positive effect
  XrpA comS negative effect
  comX/sigX late competence genes positive effect
  scnR comX/sigX positive effect
  hdrR comX/sigX positive effect
  mecA comX/sigX negative effect
  clpC comX/sigX negative effect
  comR comX/sigX positive effect
  clpP comX/sigX negative effect
  XrpA comX/sigX negative effect
  scnK comX/sigX positive effect
  comD/blpH comX/sigX positive effect
  vicK comX/sigX negative effect
  comE/blpR comX/sigX positive effect
  scnC comX/sigX positive effect
  brsR comX/sigX positive effect
  cipB comX/sigX positive effect
  vicR comX/sigX negative effect
  comC/blpC comX/sigX positive effect
  cipB comR positive effect
  hdrR comR positive effect
  XrpA comR negative effect
  comX/sigX late competence genes positive effect
  hdrM hdrR negative effect
  comD/blpH comE/blpR positive effect
  vicR comD/blpH negative effect
  comE/blpR comD/blpH positive effect
  vicK comD/blpH negative effect
  comC/blpC comD/blpH positive effect
  vicK comC/blpC negative effect
  vicK comE/blpR negative effect
  comE/blpR comC/blpC positive effect
  comE/blpR comA/nlmT positive effect
  comE/blpR comE/blpR positive effect
  comE/blpR comB/nlmE positive effect
  vicR comE/blpR negative effect
  brsM brsR negative effect
  vicR comC/blpC negative effect
  comA/nlmT comC/blpC positive effect
  comB/nlmE comC/blpC positive effect
  ciaH comC/blpC positive effect
  sepM comC/blpC positive effect

Sequence


Protein


Download         Length: 17 a.a.        Molecular weight: 2013.44 Da        Isoelectric Point: 3.7498

>NTDB_id=46 62613..62663(+) (comS) [Streptococcus mutans UA159]
MFSILTSILMGLDWWSL

Nucleotide


Download         Length: 51 bp        

>NTDB_id=46 62613..62663(+) (comS) [Streptococcus mutans UA159]
ATGTTTTCAATTTTAACAAGTATTTTGATGGGTCTTGACTGGTGGAGCTTA

XIP


This gene is known to encode the precursor of σX inducing peptide (XIP), which involves in competence development. The mature XIP sequence is displayed as below:

GLDWWSL


Domains



No domain identified.



Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value

References


[1] Antonio Pedro Ricomini Filho et al. (2019) Conserved Pheromone Production, Response and Degradation by Streptococcus mutans. Frontiers in Microbiology 10:2140. [PMID: 31572344]
[2] Simon A M Underhill et al. (2018) Intracellular Signaling by the comRS System in Streptococcus mutans Genetic Competence. MSphere 3(5):e00444-18. [PMID: 30381353]
[3] Iwona B Wenderska et al. (2017) Transcriptional Profiling of the Oral Pathogen Streptococcus mutans in Response to Competence Signaling Peptide XIP. MSystems 2(1):e00102-16. [PMID: 28066817]
[4] Justin Kaspar et al. (2017) Intercellular Communication via the comX-Inducing Peptide (XIP) of Streptococcus mutans. Journal of Bacteriology 199(21):e00404-17. [PMID: 28808131]
[5] R Khan et al. (2016) Comprehensive Transcriptome Profiles of Streptococcus mutans UA159 Map Core Streptococcal Competence Genes. MSystems 1(2):e00038-15. [PMID: 27822519]
[6] Minjun Son et al. (2015) Bidirectional signaling in the competence regulatory pathway of Streptococcus mutans. FEMS Microbiology Letters 362(19):fnv159. [PMID: 26363019]
[7] Kunal Desai et al. (2012) Development of competence for genetic transformation of Streptococcus mutans in a chemically defined medium. Journal of Bacteriology 194(15):3774-80. [PMID: 22609913]
[8] Lauren Mashburn-Warren et al. (2010) A novel double-tryptophan peptide pheromone controls competence in Streptococcus spp. via an Rgg regulator. Molecular Microbiology 78(3):589-606. [PMID: 20969646]
[9] Y H Li et al. (2001) Natural genetic transformation of Streptococcus mutans growing in biofilms. Journal of Bacteriology 183(3):897-908. [PMID: 11208787]