Detailed information NTG0347873

Bioinformatically predicted

Overview

• Name: pilA/pilA1
• Type: Machinery gene
• Locus tag: Pan97_RS13995
• Genome accession: NZ_CP036289
• Coordinates: 3484827..3484940 (-)
• Length: 37 a.a.
• NCBI ID: WP_391529966.1
• Uniprot ID: A0A518C9E7
• Organism: Bremerella volcania strain Pan97
• Function: type IV pilus biogenesis and function (predicted from homology) DNA binding and uptake

Genomic Context

Location: 3479827..3489940

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
Pan97_RS13980 (Pan97_28840)	-	3481499..3483754 (+)	2256	WP_144973509.1	alpha/beta fold hydrolase	-
Pan97_RS13985 (Pan97_28850)	-	3483937..3484575 (-)	639	WP_144973511.1	DUF1559 domain-containing protein	-
Pan97_RS27170 (Pan97_28860)	-	3484680..3484826 (-)	147	WP_144973513.1	DUF1559 domain-containing protein	-
Pan97_RS13995 (Pan97_28870)	pilA/pilA1	3484827..3484940 (-)	114	WP_391529966.1	type II secretion system protein	Machinery gene
Pan97_RS14000 (Pan97_28880)	-	3485196..3485711 (+)	516	WP_144973515.1	sigma-70 family RNA polymerase sigma factor	-
Pan97_RS14005 (Pan97_28890)	-	3485708..3487390 (+)	1683	WP_144973517.1	LamG-like jellyroll fold domain-containing protein	-

Sequence

Protein

• Length: 37 a.a.
• Molecular weight: 4100.06 Da
• Isoelectric Point: 9.6982

>NTDB_id=347873 Pan97_RS13995 WP_391529966.1 3484827..3484940(-) (pilA/pilA1) [Bremerella volcania strain Pan97]
MLRREFTLVELLVVIAIIGVLIALLLPAVQQAREAAR

Nucleotide

• Length: 114 bp

>NTDB_id=347873 Pan97_RS13995 WP_391529966.1 3484827..3484940(-) (pilA/pilA1) [Bremerella volcania strain Pan97]
ATGCTCCGTCGAGAATTTACGCTGGTCGAGCTTTTAGTAGTGATCGCCATTATTGGCGTCTTGATCGCGCTCTTACTGCC
AGCGGTACAACAAGCCCGCGAAGCGGCACGATGA

Domains

Predicted by InterproScan.

• Prokaryotic N-terminal methylation motif (N_methyl) (6-26)

3D structure

• AlphaFold DB: A0A518C9E7

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
pilA/pilA1	Synechocystis sp. PCC 6803	58.824	91.892	0.541
pilV	Deinococcus radiodurans R1 = ATCC 13939 = DSM 20539	61.29	83.784	0.514
pilE	Neisseria gonorrhoeae strain FA1090	58.621	78.378	0.459
pilE	Neisseria gonorrhoeae MS11	58.621	78.378	0.459
pilA	Vibrio campbellii strain DS40M4	54.839	83.784	0.459
fimT	Acinetobacter baylyi ADP1	47.059	91.892	0.432
comGC/cglC	Streptococcus pneumoniae D39	50	86.486	0.432
pilA	Vibrio parahaemolyticus RIMD 2210633	64	67.568	0.432
comYC	Streptococcus gordonii str. Challis substr. CH1	50	86.486	0.432
comGC/cglC	Streptococcus pneumoniae Rx1	50	86.486	0.432
comGC/cglC	Streptococcus pneumoniae R6	50	86.486	0.432
comGC/cglC	Streptococcus pneumoniae TIGR4	50	86.486	0.432
pilA/pilAII	Pseudomonas stutzeri DSM 10701	59.259	72.973	0.432
pilA/pilAI	Pseudomonas stutzeri DSM 10701	55.172	78.378	0.432
pilA	Ralstonia pseudosolanacearum GMI1000	44.444	97.297	0.432
comYC	Streptococcus suis isolate S10	46.875	86.486	0.405
comF	Acinetobacter baylyi ADP1	46.875	86.486	0.405
pilA	Vibrio cholerae strain A1552	50	75.676	0.378
ctsG	Campylobacter jejuni subsp. jejuni 81-176	40	94.595	0.378
pilA	Vibrio cholerae O1 biovar El Tor strain E7946	50	75.676	0.378
pilA	Vibrio cholerae C6706	50	75.676	0.378
xcpW	Acinetobacter baumannii D1279779	73.684	51.351	0.378
pilV	Deinococcus radiodurans R1 = ATCC 13939 = DSM 20539	73.684	51.351	0.378
comP	Neisseria meningitidis 8013	41.176	91.892	0.378
comP	Neisseria gonorrhoeae MS11	41.176	91.892	0.378
pilE	Legionella pneumophila str. Paris	35.897	100	0.378
pilE	Legionella pneumophila strain ERS1305867	35.897	100	0.378