Detailed information
Overview
| Name | comEA | Type | Machinery gene |
| Locus tag | LLB26_RS12895 | Genome accession | NZ_CP032435 |
| Coordinates | 1722133..1722234 (-) | Length | 33 a.a. |
| NCBI ID | WP_228764031.1 | Uniprot ID | A0AAJ6MIY4 |
| Organism | Lactococcus cremoris strain B26 | ||
| Function | dsDNA binding to the cell surface (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 1717133..1727234
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LLB26_RS08440 (LLB26_1669) | - | 1717478..1717693 (-) | 216 | WP_014572212.1 | F0F1 ATP synthase subunit C | - |
| LLB26_RS08445 (LLB26_1670) | - | 1717876..1718652 (-) | 777 | WP_014572211.1 | alpha/beta hydrolase family protein | - |
| LLB26_RS08450 (LLB26_1671) | - | 1718936..1719240 (-) | 305 | Protein_1678 | DNA internalization-related competence protein ComEC/Rec2 | - |
| LLB26_RS08455 (LLB26_1672) | - | 1719261..1720151 (-) | 891 | WP_081213191.1 | IS982-like element IS982B family transposase | - |
| LLB26_RS12890 (LLB26_1673) | comEC | 1720228..1720737 (-) | 510 | WP_228764033.1 | MBL fold metallo-hydrolase | Machinery gene |
| LLB26_RS08460 (LLB26_1674) | comEC | 1720734..1722005 (-) | 1272 | WP_324187032.1 | ComEC/Rec2 family competence protein | Machinery gene |
| LLB26_RS12895 | comEA | 1722133..1722234 (-) | 102 | WP_228764031.1 | helix-hairpin-helix domain-containing protein | Machinery gene |
| LLB26_RS08465 (LLB26_1675) | comEA | 1722231..1722713 (-) | 483 | WP_237025447.1 | SLBB domain-containing protein | Machinery gene |
| LLB26_RS08470 (LLB26_1676) | - | 1722844..1724205 (-) | 1362 | WP_014572203.1 | ABC transporter permease | - |
| LLB26_RS08475 (LLB26_1677) | - | 1724202..1725134 (-) | 933 | WP_014572202.1 | ABC transporter ATP-binding protein | - |
| LLB26_RS08480 (LLB26_1678) | - | 1725240..1725638 (-) | 399 | WP_011676775.1 | hypothetical protein | - |
| LLB26_RS08485 (LLB26_1679) | - | 1725755..1726314 (-) | 560 | Protein_1687 | N-acetyltransferase family protein | - |
Sequence
Protein
Download Length: 33 a.a. Molecular weight: 3658.14 Da Isoelectric Point: 4.4911
>NTDB_id=315895 LLB26_RS12895 WP_228764031.1 1722133..1722234(-) (comEA) [Lactococcus cremoris strain B26]
MKNGDFKSIEDLGKVSGFGDKTLEKLKDEISID
MKNGDFKSIEDLGKVSGFGDKTLEKLKDEISID
Nucleotide
Download Length: 102 bp
>NTDB_id=315895 LLB26_RS12895 WP_228764031.1 1722133..1722234(-) (comEA) [Lactococcus cremoris strain B26]
ATGAAAAATGGTGACTTTAAATCAATAGAGGATTTGGGTAAAGTATCTGGCTTTGGGGATAAAACATTAGAAAAATTGAA
AGATGAGATTTCTATTGATTAA
ATGAAAAATGGTGACTTTAAATCAATAGAGGATTTGGGTAAAGTATCTGGCTTTGGGGATAAAACATTAGAAAAATTGAA
AGATGAGATTTCTATTGATTAA
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.