Detailed information
Overview
| Name | comEA | Type | Machinery gene |
| Locus tag | LLUC109_RS08610 | Genome accession | NZ_CP015907 |
| Coordinates | 1707908..1708009 (-) | Length | 33 a.a. |
| NCBI ID | WP_228764031.1 | Uniprot ID | A0AAJ6MIY4 |
| Organism | Lactococcus cremoris strain UC109 | ||
| Function | dsDNA binding to the cell surface (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 1702908..1713009
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LLUC109_RS08580 (LLUC109_1655) | - | 1703253..1703468 (-) | 216 | WP_014572212.1 | F0F1 ATP synthase subunit C | - |
| LLUC109_RS08585 (LLUC109_1656) | - | 1703651..1704427 (-) | 777 | WP_014572211.1 | alpha/beta hydrolase family protein | - |
| LLUC109_RS08590 (LLUC109_1657) | - | 1704711..1705015 (-) | 305 | Protein_1670 | ComEC/Rec2 family competence protein | - |
| LLUC109_RS08595 (LLUC109_1658) | - | 1705036..1705926 (-) | 891 | WP_318175638.1 | IS982-like element IS982B family transposase | - |
| LLUC109_RS08600 (LLUC109_02940) | comEC | 1706003..1706512 (-) | 510 | WP_228764033.1 | MBL fold metallo-hydrolase | Machinery gene |
| LLUC109_RS08605 (LLUC109_1659) | comEC | 1706509..1707780 (-) | 1272 | WP_324187032.1 | ComEC/Rec2 family competence protein | Machinery gene |
| LLUC109_RS08610 (LLUC109_02945) | comEA | 1707908..1708009 (-) | 102 | WP_228764031.1 | helix-hairpin-helix domain-containing protein | Machinery gene |
| LLUC109_RS08615 (LLUC109_02950) | comEA | 1708006..1708488 (-) | 483 | WP_237025447.1 | SLBB domain-containing protein | Machinery gene |
| LLUC109_RS08620 (LLUC109_1661) | - | 1708619..1709980 (-) | 1362 | WP_014572203.1 | ABC transporter permease | - |
| LLUC109_RS08625 (LLUC109_1662) | - | 1709977..1710909 (-) | 933 | WP_014572202.1 | ABC transporter ATP-binding protein | - |
| LLUC109_RS08630 (LLUC109_1663) | - | 1711015..1711413 (-) | 399 | WP_011676775.1 | hypothetical protein | - |
| LLUC109_RS08635 (LLUC109_1664) | - | 1711530..1712089 (-) | 560 | Protein_1679 | GNAT family N-acetyltransferase | - |
Sequence
Protein
Download Length: 33 a.a. Molecular weight: 3658.14 Da Isoelectric Point: 4.4911
>NTDB_id=183326 LLUC109_RS08610 WP_228764031.1 1707908..1708009(-) (comEA) [Lactococcus cremoris strain UC109]
MKNGDFKSIEDLGKVSGFGDKTLEKLKDEISID
MKNGDFKSIEDLGKVSGFGDKTLEKLKDEISID
Nucleotide
Download Length: 102 bp
>NTDB_id=183326 LLUC109_RS08610 WP_228764031.1 1707908..1708009(-) (comEA) [Lactococcus cremoris strain UC109]
ATGAAAAATGGTGACTTTAAATCAATAGAGGATTTGGGTAAAGTATCTGGCTTTGGGGATAAAACATTAGAAAAATTGAA
AGATGAGATTTCTATTGATTAA
ATGAAAAATGGTGACTTTAAATCAATAGAGGATTTGGGTAAAGTATCTGGCTTTGGGGATAAAACATTAGAAAAATTGAA
AGATGAGATTTCTATTGATTAA
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.