Detailed information
Overview
| Name | comEA | Type | Machinery gene |
| Locus tag | LL158_RS08650 | Genome accession | NZ_CP015894 |
| Coordinates | 1722194..1722295 (-) | Length | 33 a.a. |
| NCBI ID | WP_228764031.1 | Uniprot ID | A0AAJ6MIY4 |
| Organism | Lactococcus cremoris strain 158 | ||
| Function | dsDNA binding to the cell surface (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 1717194..1727295
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LL158_RS08620 (LL158_1669) | - | 1717539..1717754 (-) | 216 | WP_014572212.1 | F0F1 ATP synthase subunit C | - |
| LL158_RS08625 (LL158_1670) | - | 1717937..1718713 (-) | 777 | WP_014572211.1 | alpha/beta hydrolase family protein | - |
| LL158_RS08630 (LL158_1671) | - | 1718997..1719301 (-) | 305 | Protein_1678 | ComEC/Rec2 family competence protein | - |
| LL158_RS08635 (LL158_1672) | - | 1719322..1720212 (-) | 891 | WP_301702468.1 | IS982-like element IS982B family transposase | - |
| LL158_RS08640 (LL158_03065) | comEC | 1720289..1720798 (-) | 510 | WP_228764033.1 | MBL fold metallo-hydrolase | Machinery gene |
| LL158_RS08645 (LL158_1673) | comEC | 1720795..1722066 (-) | 1272 | WP_324187032.1 | ComEC/Rec2 family competence protein | Machinery gene |
| LL158_RS08650 (LL158_03070) | comEA | 1722194..1722295 (-) | 102 | WP_228764031.1 | helix-hairpin-helix domain-containing protein | Machinery gene |
| LL158_RS08655 (LL158_03075) | comEA | 1722292..1722774 (-) | 483 | WP_237025447.1 | SLBB domain-containing protein | Machinery gene |
| LL158_RS08660 (LL158_1675) | - | 1722905..1724266 (-) | 1362 | WP_014572203.1 | ABC transporter permease | - |
| LL158_RS08665 (LL158_1676) | - | 1724263..1725195 (-) | 933 | WP_014572202.1 | ABC transporter ATP-binding protein | - |
| LL158_RS08670 (LL158_1677) | - | 1725301..1725699 (-) | 399 | WP_011676775.1 | hypothetical protein | - |
| LL158_RS08675 (LL158_1678) | - | 1725816..1726375 (-) | 560 | Protein_1687 | GNAT family N-acetyltransferase | - |
Sequence
Protein
Download Length: 33 a.a. Molecular weight: 3658.14 Da Isoelectric Point: 4.4911
>NTDB_id=182838 LL158_RS08650 WP_228764031.1 1722194..1722295(-) (comEA) [Lactococcus cremoris strain 158]
MKNGDFKSIEDLGKVSGFGDKTLEKLKDEISID
MKNGDFKSIEDLGKVSGFGDKTLEKLKDEISID
Nucleotide
Download Length: 102 bp
>NTDB_id=182838 LL158_RS08650 WP_228764031.1 1722194..1722295(-) (comEA) [Lactococcus cremoris strain 158]
ATGAAAAATGGTGACTTTAAATCAATAGAGGATTTGGGTAAAGTATCTGGCTTTGGGGATAAAACATTAGAAAAATTGAA
AGATGAGATTTCTATTGATTAA
ATGAAAAATGGTGACTTTAAATCAATAGAGGATTTGGGTAAAGTATCTGGCTTTGGGGATAAAACATTAGAAAAATTGAA
AGATGAGATTTCTATTGATTAA
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.