Detailed information
Overview
| Name | phrC | Type | Regulator |
| Locus tag | BSU_03780 | Genome accession | NC_000964 |
| Coordinates | 429963..430085 (+) | Length | 40 a.a. |
| NCBI ID | NP_388260.1 | Uniprot ID | P94416 |
| Organism | Bacillus subtilis subsp. subtilis str. 168 | ||
| Function | antagonize RapC Competence regulation |
||
Genomic Context
Location: 424963..435085
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| BSU_03750 (BSU03750) | yclJ | 426577..427260 (+) | 684 | NP_388257.1 | two-component response regulator [YclK] (possibly involved in arabinogalactan metabolism) | - |
| BSU_03760 (BSU03760) | yclK | 427247..428668 (+) | 1422 | NP_388258.1 | two-component sensor histidine kinase [YclJ] | - |
| BSU_03770 (BSU03770) | rapC | 428831..429979 (+) | 1149 | NP_388259.1 | response regulator aspartate phosphatase | Regulator |
| BSU_03780 (BSU03780) | phrC | 429963..430085 (+) | 123 | NP_388260.1 | secreted regulator of the activity of phosphatase RapC and competence and sporulation stimulating factor (CSF) | Regulator |
| BSU_03788 (BSU03788) | yczM | 430185..430274 (-) | 90 | YP_003097676.1 | putative type I toxin | - |
| BSU_03789 (BSU03789) | yczN | 430356..430469 (-) | 114 | YP_003097677.1 | putative spore and germination protein | - |
| BSU_03790 (BSU03790) | thrD | 430623..431987 (-) | 1365 | NP_388261.1 | aspartate kinase III | - |
| BSU_03800 (BSU03800) | ceuB | 432372..433322 (+) | 951 | NP_388262.1 | petrobactin iron-siderophore ABC transporter (permease) | Machinery gene |
| BSU_03810 (BSU03810) | pbtO | 433315..434262 (+) | 948 | NP_388263.1 | petrobactin iron-siderophore ABC transporter (permease) | - |
| BSU_03820 (BSU03820) | pbtP | 434256..435014 (+) | 759 | NP_388264.1 | petrobactin iron-siderophore ABC transporter (ATP-binding protein) | - |
Regulatory network
Positive effect
Negative effect
| Regulator | Target | Regulation |
|---|---|---|
| phrC | rapC | negative effect |
| rapC | comA | negative effect |
| comA | comS | positive effect |
| comS | comK | positive effect |
| comK | comK | positive effect |
| comK | late competence genes | positive effect |
| codY | comK | negative effect |
| clpP | comK | negative effect |
| mecA | comK | negative effect |
| kre | comK | negative effect |
| abrB | comK | negative effect |
| spo0A | comK | positive effect |
| rok | comK | negative effect |
| degU | comK | positive effect |
| clpC | comK | negative effect |
| med | comK | positive effect |
| spo0A | comK | negative effect |
| comK | late competence genes | positive effect |
| clpP | degU | negative effect |
| abrB | rok | negative effect |
| spo0A | abrB | negative effect |
| spo0A | rok | negative effect |
| ylbF | spo0A | positive effect |
| ymcA | spo0A | positive effect |
| sinR | spo0A | negative effect |
| yaaT | spo0A | positive effect |
| sinR | rok | negative effect |
| sinR | degU | negative effect |
| degQ | degU | positive effect |
| clpC | degU | negative effect |
| degS | degU | positive effect |
| rapF | comA | negative effect |
| comP | comA | positive effect |
| sinI | sinR | negative effect |
| phrF | rapF | negative effect |
| comX | comP | positive effect |
| comQ | comX | positive effect |
Sequence
Protein
Download Length: 40 a.a. Molecular weight: 4197.98 Da Isoelectric Point: 8.0285
>NTDB_id=127 BSU_03780 NP_388260.1 429963..430085(+) (phrC) [Bacillus subtilis subsp. subtilis str. 168]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT
Nucleotide
Download Length: 123 bp
>NTDB_id=127 BSU_03780 NP_388260.1 429963..430085(+) (phrC) [Bacillus subtilis subsp. subtilis str. 168]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| phrF | Bacillus subtilis subsp. subtilis str. 168 |
48.718 |
100 |
0.487 |
Multiple sequence alignment
References
| [1] | Ramses Gallegos-Monterrosa et al. (2021) Impact of Rap-Phr system abundance on adaptation of Bacillus subtilis. Communications Biology 4(1):468. [PMID: 33850233] |
| [2] | Kassem Hamze et al. (2009) Identification of genes required for different stages of dendritic swarming in Bacillus subtilis, with a novel role for phrC. Microbiology (Reading, England) 155(Pt 2):398-412. [PMID: 19202088] |
| [3] | Leighton Core et al. (2003) TPR-mediated interaction of RapC with ComA inhibits response regulator-DNA binding for competence development in Bacillus subtilis. Molecular Microbiology 49(6):1509-22. [PMID: 12950917] |