Detailed information    

experimental Experimentally validated

Overview


Name   phrC   Type   Regulator
Locus tag   BSU_03780 Genome accession   NC_000964
Coordinates   429963..430085 (+) Length   40 a.a.
NCBI ID   NP_388260.1    Uniprot ID   P94416
Organism   Bacillus subtilis subsp. subtilis str. 168     
Function   antagonize RapC   
Competence regulation

Function


PhrC is a signaling peptide that antagonizes RapC. At high cell density, PhrC accumulates and binds to RapC, inducing a conformational change that releases ComA from inhibition, thereby promoting competence.


Genomic Context


Location: 424963..435085
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BSU_03750 (BSU03750) yclJ 426577..427260 (+) 684 NP_388257.1 two-component response regulator [YclK] (possibly involved in arabinogalactan metabolism) -
  BSU_03760 (BSU03760) yclK 427247..428668 (+) 1422 NP_388258.1 two-component sensor histidine kinase [YclJ] -
  BSU_03770 (BSU03770) rapC 428831..429979 (+) 1149 NP_388259.1 response regulator aspartate phosphatase Regulator
  BSU_03780 (BSU03780) phrC 429963..430085 (+) 123 NP_388260.1 secreted regulator of the activity of phosphatase RapC and competence and sporulation stimulating factor (CSF) Regulator
  BSU_03788 (BSU03788) yczM 430185..430274 (-) 90 YP_003097676.1 putative type I toxin -
  BSU_03789 (BSU03789) yczN 430356..430469 (-) 114 YP_003097677.1 putative spore and germination protein -
  BSU_03790 (BSU03790) thrD 430623..431987 (-) 1365 NP_388261.1 aspartate kinase III -
  BSU_03800 (BSU03800) ceuB 432372..433322 (+) 951 NP_388262.1 petrobactin iron-siderophore ABC transporter (permease) Machinery gene
  BSU_03810 (BSU03810) pbtO 433315..434262 (+) 948 NP_388263.1 petrobactin iron-siderophore ABC transporter (permease) -
  BSU_03820 (BSU03820) pbtP 434256..435014 (+) 759 NP_388264.1 petrobactin iron-siderophore ABC transporter (ATP-binding protein) -

Regulatory network


Positive effect      
Negative effect
Regulator Target Regulation
  phrC rapC negative effect
  rapC comA negative effect
  comA comS positive effect
  comS comK positive effect
  comK comK positive effect
  comK late competence genes positive effect
  codY comK negative effect
  clpP comK negative effect
  mecA comK negative effect
  kre comK negative effect
  abrB comK negative effect
  spo0A comK positive effect
  rok comK negative effect
  degU comK positive effect
  clpC comK negative effect
  med comK positive effect
  spo0A comK negative effect
  comK late competence genes positive effect
  clpP degU negative effect
  abrB rok negative effect
  spo0A abrB negative effect
  spo0A rok negative effect
  ylbF spo0A positive effect
  ymcA spo0A positive effect
  sinR spo0A negative effect
  yaaT spo0A positive effect
  sinR rok negative effect
  sinR degU negative effect
  degQ degU positive effect
  clpC degU negative effect
  degS degU positive effect
  rapF comA negative effect
  comP comA positive effect
  sinI sinR negative effect
  phrF rapF negative effect
  comX comP positive effect
  comQ comX positive effect

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=127 BSU_03780 NP_388260.1 429963..430085(+) (phrC) [Bacillus subtilis subsp. subtilis str. 168]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=127 BSU_03780 NP_388260.1 429963..430085(+) (phrC) [Bacillus subtilis subsp. subtilis str. 168]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB P94416

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrF Bacillus subtilis subsp. subtilis str. 168

48.718

100

0.487


Multiple sequence alignment    



References


[1] Ramses Gallegos-Monterrosa et al. (2021) Impact of Rap-Phr system abundance on adaptation of Bacillus subtilis. Communications Biology 4(1):468. [PMID: 33850233]
[2] Kassem Hamze et al. (2009) Identification of genes required for different stages of dendritic swarming in Bacillus subtilis, with a novel role for phrC. Microbiology (Reading, England) 155(Pt 2):398-412. [PMID: 19202088]
[3] Leighton Core et al. (2003) TPR-mediated interaction of RapC with ComA inhibits response regulator-DNA binding for competence development in Bacillus subtilis. Molecular Microbiology 49(6):1509-22. [PMID: 12950917]