Detailed information
Bioinformatically predicted
Overview
| Name | comEA | Type | Machinery gene |
| Locus tag | LLA22_RS08625 | Genome accession | NZ_CP128421 |
| Coordinates | 1721167..1721268 (-) | Length | 33 a.a. |
| NCBI ID | WP_228764031.1 | Uniprot ID | A0AAJ6MIY4 |
| Organism | Lactococcus cremoris strain A.2.2 | ||
| Function | dsDNA binding to the cell surface (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 1716167..1726268
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| LLA22_RS08595 (LLA22_08655) | - | 1716512..1716727 (-) | 216 | WP_014572212.1 | F0F1 ATP synthase subunit C | - |
| LLA22_RS08600 (LLA22_08660) | - | 1716910..1717686 (-) | 777 | WP_014572211.1 | alpha/beta hydrolase family protein | - |
| LLA22_RS08605 (LLA22_08665) | - | 1717970..1718274 (-) | 305 | Protein_1675 | ComEC/Rec2 family competence protein | - |
| LLA22_RS08610 (LLA22_08670) | - | 1718295..1719185 (-) | 891 | WP_081213191.1 | IS982-like element IS982B family transposase | - |
| LLA22_RS08615 (LLA22_08675) | comEC | 1719262..1719771 (-) | 510 | WP_228764033.1 | MBL fold metallo-hydrolase | Machinery gene |
| LLA22_RS08620 (LLA22_08680) | comEC | 1719768..1721039 (-) | 1272 | WP_324187032.1 | ComEC/Rec2 family competence protein | Machinery gene |
| LLA22_RS08625 (LLA22_08685) | comEA | 1721167..1721268 (-) | 102 | WP_228764031.1 | helix-hairpin-helix domain-containing protein | Machinery gene |
| LLA22_RS08630 (LLA22_08690) | comEA | 1721265..1721747 (-) | 483 | WP_237025447.1 | SLBB domain-containing protein | Machinery gene |
| LLA22_RS08635 (LLA22_08695) | - | 1721878..1723239 (-) | 1362 | WP_014572203.1 | ABC transporter permease | - |
| LLA22_RS08640 (LLA22_08700) | - | 1723236..1724168 (-) | 933 | WP_014572202.1 | ABC transporter ATP-binding protein | - |
| LLA22_RS08645 (LLA22_08705) | - | 1724274..1724672 (-) | 399 | WP_011676775.1 | hypothetical protein | - |
| LLA22_RS08650 (LLA22_08710) | - | 1724789..1725348 (-) | 560 | Protein_1684 | GNAT family N-acetyltransferase | - |
Sequence
Protein
Download Length: 33 a.a. Molecular weight: 3658.14 Da Isoelectric Point: 4.4911
>NTDB_id=847431 LLA22_RS08625 WP_228764031.1 1721167..1721268(-) (comEA) [Lactococcus cremoris strain A.2.2]
MKNGDFKSIEDLGKVSGFGDKTLEKLKDEISID
MKNGDFKSIEDLGKVSGFGDKTLEKLKDEISID
Nucleotide
Download Length: 102 bp
>NTDB_id=847431 LLA22_RS08625 WP_228764031.1 1721167..1721268(-) (comEA) [Lactococcus cremoris strain A.2.2]
ATGAAAAATGGTGACTTTAAATCAATAGAGGATTTGGGTAAAGTATCTGGCTTTGGGGATAAAACATTAGAAAAATTGAA
AGATGAGATTTCTATTGATTAA
ATGAAAAATGGTGACTTTAAATCAATAGAGGATTTGGGTAAAGTATCTGGCTTTGGGGATAAAACATTAGAAAAATTGAA
AGATGAGATTTCTATTGATTAA
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.