Detailed information    

experimental Experimentally validated

Overview


Name   comS   Type   Regulator
Locus tag   - Genome accession   NC_006448
Coordinates   271077..271148 (+) Length   24 a.a.
NCBI ID   - Uniprot ID   -
Organism   Streptococcus thermophilus LMG 18311     
Function   activate transcription of comX; activate transcription of comS   
Competence regulation

Function


ComS is the precursor of the competence pheromone. ComS is secreted by as yet undiscovered transporter(s). At the cell surface, the protease Eep processes ComS, releasing the C-terminal pheromone domain named XIP (for σX inducing peptide). XIP interacts with the small chaperone protein AmiA3 and is brought to the Ami oligopeptide transporter. Once reimported, XIP then interacts with the transcriptional activator ComR and stimulates the binding of the ComR-XIP complex as a dimer to the ComR-box located in the promoter of comX and comS, thereby promoting their transcription. The ComR-XIP complex induces a positive feedback loop on ComS production, but not on ComR.


Genomic Context


Location: 266077..276148
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  STU_RS10960 (stu0266) - 266441..267394 (-) 954 WP_041826943.1 IS30 family transposase -
  STU_RS10965 (stu0267) - 267823..268362 (+) 540 WP_372585740.1 tRNA (cytidine(34)-2'-O)-methyltransferase -
  STU_RS10970 (stu0268) - 268674..269231 (+) 558 WP_002949523.1 ECF transporter S component -
  STU_RS10975 (stu0269) - 269234..269884 (+) 651 WP_011225447.1 phosphatase PAP2 family protein -
  STU_RS10980 (stu0270) comR 270090..270989 (+) 900 WP_011225448.1 helix-turn-helix domain-containing protein Regulator
  - comS 271077..271148 (+) 72 - - Regulator
  STU_RS10990 (stu0272) - 271227..272405 (+) 1179 Protein_238 ABC transporter transmembrane domain-containing protein -
  STU_RS11005 (stu0275) - 272691..273259 (+) 569 Protein_239 ATP-binding cassette domain-containing protein -
  STU_RS11010 (stu0276) - 273367..273684 (+) 318 WP_011225454.1 DUF805 domain-containing protein -
  STU_RS20385 (stu0277) - 274171..274791 (-) 621 WP_232087240.1 DUF4153 domain-containing protein -
  STU_RS11020 (stu0280) - 275472..275987 (+) 516 WP_002949547.1 AmiS/UreI family transporter -

Regulatory network


Positive effect      
Negative effect
Regulator Target Regulation
  comS comS positive effect
  comS comX positive effect
  amiC comS positive effect
  eeP comS positive effect
  amiD comS positive effect
  comR comS positive effect
  amiF comS positive effect
  amiA3 comS positive effect
  amiE comS positive effect
  comX ssbA positive effect
  comX comGE positive effect
  comX comGB positive effect
  comX comGD positive effect
  comX comGF positive effect
  comX comGG positive effect
  comX radA positive effect
  comX comEC positive effect
  comX comFC positive effect
  comX positive effect
  comX comEA positive effect
  comX comGC positive effect
  comX cinA positive effect
  comX coiA positive effect
  comX comGA positive effect
  comX comFA positive effect
  comX dprA positive effect
  clpC comX negative effect
  comR comX positive effect
  clpP comX negative effect
  mecA comX negative effect

Sequence


Protein


Download         Length: 24 a.a.        Molecular weight: 2715.48 Da        Isoelectric Point: 9.2356

>NTDB_id=322 271077..271148(+) (comS) [Streptococcus thermophilus LMG 18311]
MKTLKIFVLFSLLIAILPYFAGCL

Nucleotide


Download         Length: 72 bp        

>NTDB_id=322 271077..271148(+) (comS) [Streptococcus thermophilus LMG 18311]
TTGAAAACCCTGAAAATATTTGTACTATTTTCACTACTTATTGCTATCTTGCCTTATTTTGCAGGATGTCTT

XIP


This gene is known to encode the precursor of σX inducing peptide (XIP), which involves in competence development. The mature XIP sequence is displayed as below:

PYFAGCL


Domains



No domain identified.



Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comS Streptococcus thermophilus LMD-9

100

100

1

  comS Streptococcus salivarius strain HSISS4

83.333

100

0.833

  comS Streptococcus salivarius SK126

79.167

100

0.792


Multiple sequence alignment    



References


[1] Laura Ledesma-García et al. (2021) Coevolution of the bacterial pheromone ComS and sensor ComR fine-tunes natural transformation in streptococci. The Journal of Biological Chemistry 297(6):101346. [PMID: 34715127]
[2] Laura Ledesma-Garcia et al. (2020) Molecular dissection of pheromone selectivity in the competence signaling system ComRS of streptococci. Proceedings of The National Academy of Sciences of The United States of America 117(14):7745-7754. [PMID: 32198205]
[3] Antoine Talagas et al. (2016) Structural Insights into Streptococcal Competence Regulation by the Cell-to-Cell Communication System ComRS. PLoS Pathogens 12(12):e1005980. [PMID: 27907189]
[4] Laurie Haustenne et al. (2015) Modeling of the ComRS Signaling Pathway Reveals the Limiting Factors Controlling Competence in Streptococcus thermophilus. Frontiers in Microbiology 6:1413. [PMID: 26733960]
[5] Laetitia Fontaine et al. (2013) Mechanism of competence activation by the ComRS signalling system in streptococci. Molecular Microbiology 87(6):1113-32. [PMID: 23323845]
[6] Rozenn Gardan et al. (2013) Extracellular life cycle of ComS, the competence-stimulating peptide of Streptococcus thermophilus. Journal of Bacteriology 195(8):1845-55. [PMID: 23396911]
[7] Laetitia Fontaine et al. (2010) A novel pheromone quorum-sensing system controls the development of natural competence in Streptococcus thermophilus and Streptococcus salivarius. Journal of Bacteriology 192(5):1444-54. [PMID: 20023010]