Detailed information
Overview
| Name | comS | Type | Regulator |
| Locus tag | - | Genome accession | NZ_ACLO01000018 |
| Coordinates | 82608..82682 (-) | Length | 25 a.a. |
| NCBI ID | - | Uniprot ID | - |
| Organism | Streptococcus salivarius SK126 | ||
| Function | activate transcription of comX; activate transcription of comS Competence regulation |
||
Function
ComS is the precursor of the competence pheromone. ComS is secreted by as yet undiscovered transporter(s). At the cell surface, the protease Eep processes ComS, releasing the C-terminal pheromone domain named XIP (for σX inducing peptide). XIP interacts with the small chaperone protein AmiA3 and is brought to the Ami oligopeptide transporter. Once reimported, XIP then interacts with the transcriptional activator ComR and stimulates the binding of the ComR-XIP complex as a dimer to the ComR-box located in the promoter of comX and comS, thereby promoting their transcription. The ComR-XIP complex induces a positive feedback loop on ComS production, but not on ComR.
Genomic Context
Location: 77608..87682
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| STRSA0001_RS01265 (STRSA0001_1787) | - | 78596..79990 (+) | 1395 | WP_227826957.1 | DUF4153 domain-containing protein | - |
| STRSA0001_RS01270 (STRSA0001_1788) | - | 80042..80374 (-) | 333 | WP_002883800.1 | DUF805 domain-containing protein | - |
| STRSA0001_RS01275 (STRSA0001_1789) | comA | 80499..82595 (-) | 2097 | WP_002883724.1 | peptide cleavage/export ABC transporter | Regulator |
| - | comS | 82608..82682 (-) | 75 | - | - | Regulator |
| STRSA0001_RS01280 (STRSA0001_1790) | comR | 82770..83669 (-) | 900 | WP_002883753.1 | helix-turn-helix transcriptional regulator | Regulator |
| STRSA0001_RS01285 (STRSA0001_1791) | - | 83849..84499 (-) | 651 | WP_002883719.1 | phosphatase PAP2 family protein | - |
| STRSA0001_RS01290 (STRSA0001_1792) | - | 84502..85059 (-) | 558 | WP_002883726.1 | ECF transporter S component | - |
| STRSA0001_RS01295 (STRSA0001_1794) | - | 85349..85858 (-) | 510 | WP_002883735.1 | tRNA (cytidine(34)-2'-O)-methyltransferase | - |
| STRSA0001_RS01300 (STRSA0001_1795) | trkA | 86149..87498 (+) | 1350 | WP_002883814.1 | Trk system potassium transporter TrkA | - |
Sequence
Protein
Download Length: 25 a.a. Molecular weight: 2804.57 Da Isoelectric Point: 10.1174
MKKLKLFTLFSLLITILPYFTGCL*
Nucleotide
Download Length: 75 bp
TTGAAAAAACTAAAATTATTTACACTATTCTCACTACTTATCACTATCTTGCCCTATTTTACAGGTTGTCTTTAA
XIP
This gene is known to encode the precursor of σX inducing peptide (XIP), which involves in competence development. The mature XIP sequence is displayed as below:
Domains
No domain identified.
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comS | Streptococcus salivarius strain HSISS4 |
96 |
100 |
0.96 |
| comS | Streptococcus thermophilus LMG 18311 |
79.167 |
100 |
0.792 |
| comS | Streptococcus thermophilus LMD-9 |
79.167 |
100 |
0.792 |
Multiple sequence alignment
References
| [1] | Laetitia Fontaine et al. (2010) A novel pheromone quorum-sensing system controls the development of natural competence in Streptococcus thermophilus and Streptococcus salivarius. Journal of Bacteriology 192(5):1444-54. [PMID: 20023010] |