Detailed information    

experimental Experimentally validated

Overview

Name   comS   Type   Regulator
Locus tag   - Genome accession   NC_008532
Coordinates   273000..273071 (+) Length   24 a.a.
NCBI ID   - Uniprot ID   -
Organism   Streptococcus thermophilus LMD-9     
Function   activate transcription of comX; activate transcription of comS   
Competence regulation

Function

ComS is the precursor of the competence pheromone. ComS is secreted by as yet undiscovered transporter(s). At the cell surface, the protease Eep processes ComS, releasing the C-terminal pheromone domain named XIP (for σX inducing peptide). XIP interacts with the small chaperone protein AmiA3 and is brought to the Ami oligopeptide transporter. Once reimported, XIP then interacts with the transcriptional activator ComR and stimulates the binding of the ComR-XIP complex as a dimer to the ComR-box located in the promoter of comX and comS, thereby promoting their transcription. The ComR-XIP complex induces a positive feedback loop on ComS production, but not on ComR.


Genomic Context

Location: 268000..278071
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  STER_RS01515 (STER_0312) trkA 268150..269499 (-) 1350 WP_011225444.1 Trk system potassium transporter TrkA -
  STER_RS01520 (STER_0313) - 269758..270297 (+) 540 WP_372585740.1 tRNA (cytidine(34)-2'-O)-methyltransferase -
  STER_RS01525 (STER_0314) - 270608..271165 (+) 558 WP_011680718.1 ECF transporter S component -
  STER_RS01530 (STER_0315) - 271168..271818 (+) 651 WP_011680719.1 phosphatase PAP2 family protein -
  STER_RS01535 (STER_0316) comR 272013..272912 (+) 900 WP_011680720.1 helix-turn-helix domain-containing protein Regulator
  - comS 273000..273071 (+) 72 - - Regulator
  STER_RS11550 - 273150..273731 (+) 582 Protein_243 cysteine peptidase family C39 domain-containing protein -
  STER_RS11555 comA 273716..274006 (+) 291 WP_194238295.1 ABC transporter transmembrane domain-containing protein Regulator
  STER_RS11560 comA 274349..274558 (+) 210 WP_002946147.1 hypothetical protein Regulator
  STER_RS01555 (STER_0318) - 274613..275181 (+) 569 Protein_246 ATP-binding cassette domain-containing protein -
  STER_RS11565 (STER_0319) - 275412..275600 (+) 189 WP_224103239.1 DUF805 domain-containing protein -
  STER_RS11575 (STER_0320) - 276093..276395 (-) 303 WP_224103194.1 hypothetical protein -
  STER_RS11580 (STER_0321) - 276619..276990 (-) 372 WP_224103195.1 hypothetical protein -
  STER_RS01570 (STER_0322) - 277396..277911 (+) 516 WP_002949547.1 AmiS/UreI family transporter -

Regulatory network

Positive effect      
Negative effect
Regulator Target Regulation
  comS comX positive effect
  comX late competence genes positive effect
  comX late competence genes positive effect
  comR comX positive effect
  comR comS positive effect
  comS comS positive effect
  amiD comS positive effect
  pptA comS positive effect
  amiE comS positive effect
  eeP comS positive effect
  amiA3 comS positive effect
  pptB comS positive effect
  amiF comS positive effect
  amiC comS positive effect
  clpP comX negative effect
  mecA comX negative effect
  clpC comX negative effect

Sequence

Protein


Download         Length: 24 a.a.        Molecular weight: 2715.48 Da        Isoelectric Point: 9.2356

>NTDB_id=49 273000..273071(+) (comS) [Streptococcus thermophilus LMD-9]
MKTLKIFVLFSLLIAILPYFAGCL

Nucleotide


Download         Length: 72 bp        

>NTDB_id=49 273000..273071(+) (comS) [Streptococcus thermophilus LMD-9]
TTGAAAACCCTGAAAATATTTGTACTATTTTCACTACTTATTGCTATCTTGCCTTATTTTGCAGGATGTCTT

XIP

This gene is known to encode the precursor of σX inducing peptide (XIP), which involves in competence development. The mature XIP sequence is displayed as below:

PYFAGCL


Domains


No domain identified.



Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comS Streptococcus thermophilus LMG 18311

100

100

1
  comS Streptococcus salivarius strain HSISS4

83.333

100

0.833
  comS Streptococcus salivarius SK126

79.167

100

0.792

Multiple sequence alignment    



References

[1] Laura Ledesma-García et al. (2021) Coevolution of the bacterial pheromone ComS and sensor ComR fine-tunes natural transformation in streptococci. The Journal of Biological Chemistry 297(6):101346. [PMID: 34715127]
[2] Laura Ledesma-Garcia et al. (2020) Molecular dissection of pheromone selectivity in the competence signaling system ComRS of streptococci. Proceedings of The National Academy of Sciences of The United States of America 117(14):7745-7754. [PMID: 32198205]
[3] Antoine Talagas et al. (2016) Structural Insights into Streptococcal Competence Regulation by the Cell-to-Cell Communication System ComRS. PLoS Pathogens 12(12):e1005980. [PMID: 27907189]
[4] Laurie Haustenne et al. (2015) Modeling of the ComRS Signaling Pathway Reveals the Limiting Factors Controlling Competence in Streptococcus thermophilus. Frontiers in Microbiology 6:1413. [PMID: 26733960]
[5] Laetitia Fontaine et al. (2013) Mechanism of competence activation by the ComRS signalling system in streptococci. Molecular Microbiology 87(6):1113-32. [PMID: 23323845]
[6] Rozenn Gardan et al. (2013) Extracellular life cycle of ComS, the competence-stimulating peptide of Streptococcus thermophilus. Journal of Bacteriology 195(8):1845-55. [PMID: 23396911]
[7] Laetitia Fontaine et al. (2010) A novel pheromone quorum-sensing system controls the development of natural competence in Streptococcus thermophilus and Streptococcus salivarius. Journal of Bacteriology 192(5):1444-54. [PMID: 20023010]