Detailed information
Overview
| Name | pilA/pilA1 | Type | Machinery gene |
| Locus tag | CleRt_RS13830 | Genome accession | NZ_CP011126 |
| Coordinates | 169821..169922 (+) | Length | 33 a.a. |
| NCBI ID | WP_371440240.1 | Uniprot ID | - |
| Organism | Candidatus Coxiella mudrowiae strain CRt | ||
| Function | type IV pilus biogenesis and function (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 164821..174922
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| CleRt_RS00760 | - | 165954..166154 (+) | 201 | WP_048874824.1 | secretin N-terminal domain-containing protein | - |
| CleRt_RS11130 | - | 166323..166783 (+) | 461 | Protein_192 | type II secretion system protein GspD | - |
| CleRt_RS00770 | - | 166817..167023 (+) | 207 | WP_048874826.1 | hypothetical protein | - |
| CleRt_RS09660 | - | 167290..167430 (+) | 141 | WP_157870759.1 | hypothetical protein | - |
| CleRt_RS13815 | pilB | 167601..167750 (+) | 150 | WP_157870760.1 | ATPase, T2SS/T4P/T4SS family | Machinery gene |
| CleRt_RS08685 | pilB/pilB1 | 167779..167952 (+) | 174 | WP_082160388.1 | ATPase, T2SS/T4P/T4SS family | Machinery gene |
| CleRt_RS13820 | - | 167967..168044 (+) | 78 | WP_157870941.1 | hypothetical protein | - |
| CleRt_RS13825 | - | 168052..168255 (+) | 204 | Protein_198 | ATPase, T2SS/T4P/T4SS family | - |
| CleRt_RS08160 | - | 168225..168548 (+) | 324 | WP_053097813.1 | hypothetical protein | - |
| CleRt_RS08690 | - | 169372..169773 (+) | 402 | WP_306686886.1 | type II secretion system F family protein | - |
| CleRt_RS13830 | pilA/pilA1 | 169821..169922 (+) | 102 | WP_371440240.1 | type IV pilin protein | Machinery gene |
| CleRt_RS13835 | - | 169966..170145 (+) | 180 | WP_371440241.1 | type II secretion system protein GspG | - |
| CleRt_RS09680 | - | 170284..170427 (+) | 144 | WP_157870764.1 | hypothetical protein | - |
| CleRt_RS08695 | - | 170740..170880 (+) | 141 | Protein_204 | prepilin-type N-terminal cleavage/methylation domain-containing protein | - |
| CleRt_RS00795 | - | 171089..171412 (+) | 324 | WP_048874828.1 | type II secretion system protein J | - |
| CleRt_RS00800 | - | 171477..171752 (+) | 276 | WP_048874829.1 | type II secretion system protein GspJ | - |
| CleRt_RS12865 | - | 171862..171993 (+) | 132 | WP_306686721.1 | hypothetical protein | - |
| CleRt_RS00805 | - | 172140..172343 (+) | 204 | WP_162198803.1 | type II secretion system protein GspK | - |
| CleRt_RS09685 | - | 172416..172556 (+) | 141 | WP_157870765.1 | hypothetical protein | - |
| CleRt_RS00810 | - | 173107..173655 (+) | 549 | WP_048874831.1 | GspL/Epsl periplasmic domain-containing protein | - |
| CleRt_RS00815 | gspM | 173663..173857 (+) | 195 | WP_048874832.1 | type II secretion system protein GspM | - |
| CleRt_RS00820 | - | 173854..174135 (+) | 282 | WP_048874833.1 | type II secretion system protein M | - |
| CleRt_RS09690 | - | 174174..174335 (+) | 162 | WP_157870766.1 | hypothetical protein | - |
Sequence
Protein
Download Length: 33 a.a. Molecular weight: 3382.17 Da Isoelectric Point: 5.8614
>NTDB_id=142577 CleRt_RS13830 WP_371440240.1 169821..169922(+) (pilA/pilA1) [Candidatus Coxiella mudrowiae strain CRt]
MGGFTLIEVMVVVVILAILAAIVVANNAPSRLS
MGGFTLIEVMVVVVILAILAAIVVANNAPSRLS
Nucleotide
Download Length: 102 bp
>NTDB_id=142577 CleRt_RS13830 WP_371440240.1 169821..169922(+) (pilA/pilA1) [Candidatus Coxiella mudrowiae strain CRt]
ATGGGTGGCTTCACATTGATTGAAGTAATGGTCGTGGTTGTTATCTTAGCAATTTTGGCAGCAATTGTTGTCGCGAATAA
TGCACCGTCCCGATTAAGCTAA
ATGGGTGGCTTCACATTGATTGAAGTAATGGTCGTGGTTGTTATCTTAGCAATTTTGGCAGCAATTGTTGTCGCGAATAA
TGCACCGTCCCGATTAAGCTAA
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.