Detailed information NTG0142577

Bioinformatically predicted

Overview

• Name: pilA/pilA1
• Type: Machinery gene
• Locus tag: CleRt_RS13830
• Genome accession: NZ_CP011126
• Coordinates: 169821..169922 (+)
• Length: 33 a.a.
• NCBI ID: WP_371440240.1
• Uniprot ID: -
• Organism: Candidatus Coxiella mudrowiae strain CRt
• Function: type IV pilus biogenesis and function (predicted from homology) DNA binding and uptake

Genomic Context

Location: 164821..174922

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
CleRt_RS00760	-	165954..166154 (+)	201	WP_048874824.1	secretin N-terminal domain-containing protein	-
CleRt_RS11130	-	166323..166783 (+)	461	Protein_192	type II secretion system protein GspD	-
CleRt_RS00770	-	166817..167023 (+)	207	WP_048874826.1	hypothetical protein	-
CleRt_RS09660	-	167290..167430 (+)	141	WP_157870759.1	hypothetical protein	-
CleRt_RS13815	pilB	167601..167750 (+)	150	WP_157870760.1	ATPase, T2SS/T4P/T4SS family	Machinery gene
CleRt_RS08685	pilB/pilB1	167779..167952 (+)	174	WP_082160388.1	ATPase, T2SS/T4P/T4SS family	Machinery gene
CleRt_RS13820	-	167967..168044 (+)	78	WP_157870941.1	hypothetical protein	-
CleRt_RS13825	-	168052..168255 (+)	204	Protein_198	ATPase, T2SS/T4P/T4SS family	-
CleRt_RS08160	-	168225..168548 (+)	324	WP_053097813.1	hypothetical protein	-
CleRt_RS08690	-	169372..169773 (+)	402	WP_306686886.1	type II secretion system F family protein	-
CleRt_RS13830	pilA/pilA1	169821..169922 (+)	102	WP_371440240.1	type IV pilin protein	Machinery gene
CleRt_RS13835	-	169966..170145 (+)	180	WP_371440241.1	type II secretion system protein GspG	-
CleRt_RS09680	-	170284..170427 (+)	144	WP_157870764.1	hypothetical protein	-
CleRt_RS08695	-	170740..170880 (+)	141	Protein_204	prepilin-type N-terminal cleavage/methylation domain-containing protein	-
CleRt_RS00795	-	171089..171412 (+)	324	WP_048874828.1	type II secretion system protein J	-
CleRt_RS00800	-	171477..171752 (+)	276	WP_048874829.1	type II secretion system protein GspJ	-
CleRt_RS12865	-	171862..171993 (+)	132	WP_306686721.1	hypothetical protein	-
CleRt_RS00805	-	172140..172343 (+)	204	WP_162198803.1	type II secretion system protein GspK	-
CleRt_RS09685	-	172416..172556 (+)	141	WP_157870765.1	hypothetical protein	-
CleRt_RS00810	-	173107..173655 (+)	549	WP_048874831.1	GspL/Epsl periplasmic domain-containing protein	-
CleRt_RS00815	gspM	173663..173857 (+)	195	WP_048874832.1	type II secretion system protein GspM	-
CleRt_RS00820	-	173854..174135 (+)	282	WP_048874833.1	type II secretion system protein M	-
CleRt_RS09690	-	174174..174335 (+)	162	WP_157870766.1	hypothetical protein	-

Sequence

Protein

• Length: 33 a.a.
• Molecular weight: 3382.17 Da
• Isoelectric Point: 5.8614

>NTDB_id=142577 CleRt_RS13830 WP_371440240.1 169821..169922(+) (pilA/pilA1) [Candidatus Coxiella mudrowiae strain CRt]
MGGFTLIEVMVVVVILAILAAIVVANNAPSRLS

Nucleotide

• Length: 102 bp

>NTDB_id=142577 CleRt_RS13830 WP_371440240.1 169821..169922(+) (pilA/pilA1) [Candidatus Coxiella mudrowiae strain CRt]
ATGGGTGGCTTCACATTGATTGAAGTAATGGTCGTGGTTGTTATCTTAGCAATTTTGGCAGCAATTGTTGTCGCGAATAA
TGCACCGTCCCGATTAAGCTAA

Domains

Predicted by InterproScan.

• Prokaryotic N-terminal methylation motif (N_methyl) (3-23)

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
pilA/pilA1	Synechocystis sp. PCC 6803	64	75.758	0.485
pilA	Ralstonia pseudosolanacearum GMI1000	68.182	66.667	0.455
pilY2	Acinetobacter baumannii D1279779	68.182	66.667	0.455
pilA/pilA2	Thermus thermophilus HB27	43.75	96.97	0.424
pilA	Vibrio campbellii strain DS40M4	63.636	66.667	0.424
pilV	Deinococcus radiodurans R1 = ATCC 13939 = DSM 20539	54.167	72.727	0.394
comP	Neisseria gonorrhoeae MS11	61.905	63.636	0.394
comP	Neisseria meningitidis 8013	61.905	63.636	0.394
pilX	Neisseria meningitidis 8013	59.091	66.667	0.394
pilE	Neisseria gonorrhoeae strain FA1090	59.091	66.667	0.394
pilE	Neisseria gonorrhoeae MS11	59.091	66.667	0.394
pilA	Vibrio cholerae O1 biovar El Tor strain E7946	59.091	66.667	0.394
pilA	Vibrio cholerae strain A1552	59.091	66.667	0.394
pilA	Vibrio cholerae C6706	59.091	66.667	0.394
pilA	Vibrio parahaemolyticus RIMD 2210633	59.091	66.667	0.394
pilL	Neisseria gonorrhoeae MS11	59.091	66.667	0.394
ctsG	Campylobacter jejuni subsp. jejuni 81-176	42.857	84.848	0.364