Detailed information    

insolico Bioinformatically predicted

Overview

Name   comEA   Type   Machinery gene
Locus tag   LC048_RS04925 Genome accession   NZ_CP129019
Coordinates   997299..997376 (+) Length   25 a.a.
NCBI ID   WP_306050442.1    Uniprot ID   -
Organism   Mesobacillus subterraneus strain KcN21-5     
Function   dsDNA binding to the cell surface (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 992299..1002376
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LC048_RS04885 (LC048_04885) aroE 992381..993211 (+) 831 WP_226606994.1 shikimate dehydrogenase -
  LC048_RS04890 (LC048_04890) yhbY 993215..993508 (+) 294 WP_226606997.1 ribosome assembly RNA-binding protein YhbY -
  LC048_RS04895 (LC048_04895) - 993527..994096 (+) 570 WP_226606999.1 nicotinate-nucleotide adenylyltransferase -
  LC048_RS04900 (LC048_04900) yqeK 994086..994652 (+) 567 WP_226607001.1 bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK -
  LC048_RS04905 (LC048_04905) rsfS 994657..995010 (+) 354 WP_226607004.1 ribosome silencing factor -
  LC048_RS04910 (LC048_04910) - 995010..995756 (+) 747 WP_226607007.1 class I SAM-dependent methyltransferase -
  LC048_RS04915 (LC048_04915) comER 995848..996669 (-) 822 WP_226607009.1 late competence protein ComER -
  LC048_RS04920 (LC048_04920) - 996758..997267 (+) 510 WP_306049587.1 SLBB domain-containing protein -
  LC048_RS04925 (LC048_04925) comEA 997299..997376 (+) 78 WP_306050442.1 hypothetical protein Machinery gene
  LC048_RS04930 (LC048_04930) - 997483..997896 (+) 414 WP_226607012.1 cytidine/deoxycytidylate deaminase family protein -
  LC048_RS04935 (LC048_04935) - 997917..1000253 (+) 2337 WP_306049589.1 DNA internalization-related competence protein ComEC/Rec2 -
  LC048_RS04940 (LC048_04940) - 1000360..1000494 (-) 135 WP_226607016.1 YqzM family protein -
  LC048_RS04945 (LC048_04945) holA 1000848..1001870 (+) 1023 WP_226607017.1 DNA polymerase III subunit delta -
  LC048_RS04950 (LC048_04950) rpsT 1001938..1002198 (-) 261 WP_035209610.1 30S ribosomal protein S20 -

Sequence

Protein


Download         Length: 25 a.a.        Molecular weight: 2837.32 Da        Isoelectric Point: 4.7419

>NTDB_id=850585 LC048_RS04925 WP_306050442.1 997299..997376(+) (comEA) [Mesobacillus subterraneus strain KcN21-5]
MEDLKEISGIGDKTFEKLKDLISVK

Nucleotide


Download         Length: 78 bp        

>NTDB_id=850585 LC048_RS04925 WP_306050442.1 997299..997376(+) (comEA) [Mesobacillus subterraneus strain KcN21-5]
ATCGAAGATTTAAAAGAAATCAGCGGAATTGGTGATAAAACTTTCGAAAAATTAAAAGACTTGATTTCTGTAAAATAG

Domains


No domain identified.



Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.