Detailed information
Overview
| Name | comEA | Type | Machinery gene |
| Locus tag | A1552VC_RS08580 | Genome accession | NZ_CP028894 |
| Coordinates | 1842560..1842871 (-) | Length | 103 a.a. |
| NCBI ID | WP_001166105.1 | Uniprot ID | Q9KQT1 |
| Organism | Vibrio cholerae strain A1552 | ||
| Function | dsDNA binding DNA binding and uptake |
||
Genomic Context
Location: 1837560..1847871
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| A1552VC_RS08555 (A1552VC_01689) | lapB | 1837754..1838923 (-) | 1170 | WP_000889971.1 | lipopolysaccharide assembly protein LapB | - |
| A1552VC_RS08560 (A1552VC_01690) | - | 1838935..1839216 (-) | 282 | WP_000691492.1 | LapA family protein | - |
| A1552VC_RS08565 (A1552VC_01691) | ihfB | 1839355..1839633 (-) | 279 | WP_000167341.1 | integration host factor subunit beta | - |
| A1552VC_RS08570 (A1552VC_01692) | rpsA | 1839921..1841591 (-) | 1671 | WP_000140318.1 | 30S ribosomal protein S1 | - |
| A1552VC_RS08575 (A1552VC_01693) | cmk | 1841700..1842377 (-) | 678 | WP_000094752.1 | (d)CMP kinase | - |
| A1552VC_RS08580 (A1552VC_01694) | comEA | 1842560..1842871 (-) | 312 | WP_001166105.1 | ComEA family DNA-binding protein | Machinery gene |
| A1552VC_RS08585 (A1552VC_01695) | ppiD | 1843006..1844865 (-) | 1860 | WP_000969331.1 | peptidylprolyl isomerase | - |
| A1552VC_RS08590 (A1552VC_01696) | - | 1845018..1845290 (-) | 273 | WP_001044516.1 | HU family DNA-binding protein | - |
| A1552VC_RS08595 (A1552VC_01698) | lon | 1845474..1847834 (-) | 2361 | WP_001047611.1 | endopeptidase La | - |
Regulatory network
Positive effect
Negative effect
| Regulator | Target | Regulation |
|---|---|---|
| tfoX | comEA | positive effect |
| tfoX | pilD | positive effect |
| tfoX | pilO | positive effect |
| crp | comEA | positive effect |
| qstR | comEA | positive effect |
| hapR | comEA | positive effect |
| tfoX | pilQ | positive effect |
| tfoX | qstR | positive effect |
| qstR | comEC | positive effect |
| qstR | comF | positive effect |
| qstR | comM | positive effect |
| crp | qstR | positive effect |
| hapR | qstR | positive effect |
| tfoX | pilB | positive effect |
| tfoX | comEC | positive effect |
| hapR | comEC | positive effect |
| tfoX | pilC | positive effect |
| tfoX | pilP | positive effect |
| tfoX | pilA | positive effect |
| tfoX | dprA | positive effect |
| tfoX | pilM | positive effect |
| tfoX | pilN | positive effect |
| chiS | tfoX | positive effect |
| hapR | dns | negative effect |
Sequence
Protein
Download Length: 103 a.a. Molecular weight: 10966.78 Da Isoelectric Point: 5.0506
>NTDB_id=1150 A1552VC_RS08580 WP_001166105.1 1842560..1842871(-) (comEA) [Vibrio cholerae strain A1552]
MQIKTKIVTLFLSLCLPTLPLLANAEETAPAAQVEEGIVITVNINTASAEELATLLKGIGLKKAQAIVDYREANGPFTHI
DDLTNVKGIGEATVRNNAARILL
MQIKTKIVTLFLSLCLPTLPLLANAEETAPAAQVEEGIVITVNINTASAEELATLLKGIGLKKAQAIVDYREANGPFTHI
DDLTNVKGIGEATVRNNAARILL
Nucleotide
Download Length: 312 bp
>NTDB_id=1150 A1552VC_RS08580 WP_001166105.1 1842560..1842871(-) (comEA) [Vibrio cholerae strain A1552]
ATGCAAATCAAAACCAAAATAGTGACACTGTTTCTTTCTCTCTGCCTGCCGACATTACCGTTACTGGCCAATGCCGAGGA
AACGGCACCCGCTGCGCAGGTAGAAGAAGGTATTGTGATCACTGTCAATATTAATACCGCTTCTGCAGAAGAGCTGGCGA
CGTTACTCAAAGGCATCGGGCTTAAGAAAGCTCAGGCCATTGTCGATTATCGAGAAGCCAACGGTCCTTTTACTCATATC
GATGATCTGACGAATGTGAAAGGGATTGGTGAAGCGACAGTGCGCAACAATGCCGCAAGGATCTTGTTATAA
ATGCAAATCAAAACCAAAATAGTGACACTGTTTCTTTCTCTCTGCCTGCCGACATTACCGTTACTGGCCAATGCCGAGGA
AACGGCACCCGCTGCGCAGGTAGAAGAAGGTATTGTGATCACTGTCAATATTAATACCGCTTCTGCAGAAGAGCTGGCGA
CGTTACTCAAAGGCATCGGGCTTAAGAAAGCTCAGGCCATTGTCGATTATCGAGAAGCCAACGGTCCTTTTACTCATATC
GATGATCTGACGAATGTGAAAGGGATTGGTGAAGCGACAGTGCGCAACAATGCCGCAAGGATCTTGTTATAA
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comEA | Vibrio cholerae C6706 |
100 |
100 |
1 |
| comEA | Vibrio parahaemolyticus RIMD 2210633 |
62.766 |
100 |
0.628 |
| comEA | Vibrio campbellii strain DS40M4 |
58.333 |
100 |
0.589 |
| comE1/comEA | Haemophilus influenzae Rd KW20 |
40.541 |
100 |
0.437 |
| Cj0011c | Campylobacter jejuni subsp. jejuni NCTC 11168 = ATCC 700819 |
62.745 |
64.557 |
0.405 |
Multiple sequence alignment
References
| [1] | Patrick Seitz et al. (2014) ComEA is essential for the transfer of external DNA into the periplasm in naturally transformable Vibrio cholerae cells. PLoS Genetics 10(1):e1004066. [PMID: 24391524] |
| [2] | Patrick Seitz et al. (2014) DNA transport across the outer and inner membranes of naturally transformable Vibrio cholerae is spatially but not temporally coupled. MBio 5(4):e01409-14. [PMID: 25139903] |
| [3] | Mirella Lo Scrudato et al. (2014) Regulatory elements involved in the expression of competence genes in naturally transformable Vibrio cholerae. BMC Microbiology 14:327. [PMID: 25539806] |
| [4] | Patrick Seitz et al. (2013) DNA-uptake machinery of naturally competent Vibrio cholerae. Proceedings of The National Academy of Sciences of The United States of America 110(44):17987-92. [PMID: 24127573] |
| [5] | Gaia Suckow et al. (2011) Quorum sensing contributes to natural transformation of Vibrio cholerae in a species-specific manner. Journal of Bacteriology 193(18):4914-24. [PMID: 21784943] |