Detailed information NTG0787627

Bioinformatically predicted

Overview

• Name: pilV
• Type: Machinery gene
• Locus tag: PQO03_RS16210
• Genome accession: NZ_CP117812
• Coordinates: 1197220..1197327 (-)
• Length: 35 a.a.
• NCBI ID: WP_274154238.1
• Uniprot ID: -
• Organism: Lentisphaera profundi strain SAORIC-696
• Function: assembly of type IV pilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 1192220..1202327

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
PQO03_RS16200 (PQO03_16200)	-	1194504..1195496 (+)	993	WP_274148572.1	IS30 family transposase	-
PQO03_RS16205 (PQO03_16205)	-	1195651..1197138 (+)	1488	WP_274154237.1	sulfatase-like hydrolase/transferase	-
PQO03_RS16210 (PQO03_16210)	pilV	1197220..1197327 (-)	108	WP_274154238.1	prepilin-type N-terminal cleavage/methylation domain-containing protein	Machinery gene
PQO03_RS16215 (PQO03_16215)	-	1197633..1198406 (+)	774	WP_274154239.1	type II secretion system protein	-
PQO03_RS16220 (PQO03_16220)	-	1198456..1198710 (-)	255	WP_274154240.1	hypothetical protein	-
PQO03_RS16225 (PQO03_16225)	-	1198894..1199235 (-)	342	WP_274154241.1	hypothetical protein	-
PQO03_RS16230 (PQO03_16230)	-	1199246..1200571 (-)	1326	WP_274154242.1	sulfite oxidase	-

Sequence

Protein

• Length: 35 a.a.
• Molecular weight: 3859.91 Da
• Isoelectric Point: 9.0179

>NTDB_id=787627 PQO03_RS16210 WP_274154238.1 1197220..1197327(-) (pilV) [Lentisphaera profundi strain SAORIC-696]
MKKFTLIELMVVIAIIGILTSLLLLTLSGSMLVHF

Nucleotide

• Length: 108 bp

>NTDB_id=787627 PQO03_RS16210 WP_274154238.1 1197220..1197327(-) (pilV) [Lentisphaera profundi strain SAORIC-696]
ATGAAAAAATTCACTCTTATAGAGTTGATGGTCGTCATTGCCATAATCGGTATTTTAACGAGCTTATTATTACTTACACT
AAGCGGCAGCATGCTTGTACATTTTTAA

Domains

Predicted by InterproScan.

• Prokaryotic N-terminal methylation motif (N_methyl) (4-23)

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
pilV	Deinococcus radiodurans R1 = ATCC 13939 = DSM 20539	62.963	77.143	0.486
comYD	Streptococcus mutans UA140	48.571	100	0.486
comYD	Streptococcus mutans UA159	48.571	100	0.486
pilE	Neisseria gonorrhoeae strain FA1090	69.565	65.714	0.457
pilE	Neisseria gonorrhoeae MS11	69.565	65.714	0.457
pilA	Vibrio campbellii strain DS40M4	71.429	60	0.429
pilV	Deinococcus radiodurans R1 = ATCC 13939 = DSM 20539	78.947	54.286	0.429
pilA/pilA1	Synechocystis sp. PCC 6803	53.571	80	0.429
pilA	Ralstonia pseudosolanacearum GMI1000	60.87	65.714	0.4
fimT	Acinetobacter baylyi ADP1	66.667	60	0.4
ctsG	Campylobacter jejuni subsp. jejuni 81-176	48.276	82.857	0.4
comGF	Latilactobacillus sakei subsp. sakei 23K	50	80	0.4
pilA	Vibrio cholerae C6706	56.522	65.714	0.371
pilA	Vibrio cholerae strain A1552	56.522	65.714	0.371
pilA	Vibrio cholerae O1 biovar El Tor strain E7946	56.522	65.714	0.371
pilY2	Acinetobacter baumannii D1279779	61.905	60	0.371
pilA	Vibrio parahaemolyticus RIMD 2210633	72.222	51.429	0.371